Incidental Mutation 'R9275:Cyp2c67'
ID 703264
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms C730004C24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9275 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 39608842-39649051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 39609255 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 433 (R433Q)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
AlphaFold Q569X9
Predicted Effect probably damaging
Transcript: ENSMUST00000067328
AA Change: R433Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: R433Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,464,282 Y249H probably damaging Het
AF067063 T C 13: 119,828,457 S68G possibly damaging Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Akap11 C A 14: 78,513,709 V413F Het
Ank3 T C 10: 69,986,832 S444P probably damaging Het
Ankrd12 C T 17: 66,037,604 E91K possibly damaging Het
Arhgap10 A G 8: 77,411,036 S309P probably damaging Het
Arpc2 C A 1: 74,236,882 F19L probably benign Het
Atp5a1 C T 18: 77,781,297 T457I probably damaging Het
Bsn C T 9: 108,111,620 R2311H probably damaging Het
C1ra A G 6: 124,517,424 T277A probably benign Het
Celsr3 C G 9: 108,838,490 L2124V probably benign Het
Cenpv T C 11: 62,525,163 *253W probably null Het
Cfap54 A T 10: 93,039,186 V479E possibly damaging Het
Cmpk2 A T 12: 26,469,569 Y73F probably benign Het
Cpne2 T C 8: 94,555,015 I226T possibly damaging Het
Dagla A G 19: 10,254,856 Y489H probably damaging Het
Dennd4a C A 9: 64,842,624 P166T probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Enpp2 C T 15: 54,850,088 R658Q probably benign Het
Gm10521 G A 1: 171,896,463 V114I unknown Het
Gm7534 A G 4: 134,195,459 L521P probably damaging Het
H2-T24 T A 17: 36,017,384 E69V probably damaging Het
H6pd T A 4: 149,995,850 K179N probably damaging Het
Hsf2bp C T 17: 31,987,362 W265* probably null Het
Igfn1 C A 1: 135,973,447 R431L probably damaging Het
Kcng2 T C 18: 80,295,859 S405G possibly damaging Het
Leng9 T C 7: 4,148,448 T410A probably benign Het
Lrp1b T C 2: 40,597,064 Y4557C Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mlkl A G 8: 111,316,423 V364A probably benign Het
Mns1 T A 9: 72,449,225 F254Y probably benign Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Neb C T 2: 52,256,178 R2929H probably damaging Het
Olfr1025-ps1 A G 2: 85,918,702 Y259C probably benign Het
Olfr111 T A 17: 37,530,928 M317K probably benign Het
Pde10a A G 17: 8,981,656 *797W probably null Het
Pirb T G 7: 3,716,860 H429P probably benign Het
Plbd1 A G 6: 136,617,288 L321P probably damaging Het
Pmfbp1 A G 8: 109,535,839 I722V probably benign Het
Polr2b A G 5: 77,323,638 R274G probably damaging Het
Prune2 C T 19: 17,123,780 T2216I probably benign Het
Psma3 A T 12: 70,994,382 D252V probably benign Het
Ptpn1 C T 2: 167,974,256 T230I probably damaging Het
Rhpn1 T C 15: 75,713,271 V519A possibly damaging Het
Rnf213 T C 11: 119,435,942 V1586A Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Ryr2 T C 13: 11,883,090 T140A probably benign Het
Scn1a T A 2: 66,299,682 Y243F probably damaging Het
Sdk1 A G 5: 141,956,198 T534A possibly damaging Het
Slc27a5 T C 7: 12,997,713 D117G probably damaging Het
Slc2a1 A T 4: 119,133,410 E246D probably benign Het
Smpd2 T C 10: 41,487,689 D289G probably benign Het
Spag6 A C 2: 18,699,174 E11A probably benign Het
Stard3 G A 11: 98,372,105 probably benign Het
Tcf19 A G 17: 35,515,002 V86A probably damaging Het
Tigit A T 16: 43,659,470 M154K probably benign Het
Trim34a T A 7: 104,260,994 N334K probably damaging Het
Tsen15 T C 1: 152,383,347 I87V probably damaging Het
Ttn A T 2: 76,907,874 M4153K unknown Het
Uchl3 A T 14: 101,668,527 probably null Het
Usp1 A G 4: 98,931,341 K347E probably damaging Het
Vmn1r73 T C 7: 11,756,552 M99T probably benign Het
Vmn2r20 A G 6: 123,385,435 W797R probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39640008 missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39638674 missense probably benign 0.01
R8717:Cyp2c67 UTSW 19 39638711 missense probably benign 0.05
R8728:Cyp2c67 UTSW 19 39626161 missense probably damaging 1.00
R9278:Cyp2c67 UTSW 19 39609255 missense probably damaging 1.00
R9376:Cyp2c67 UTSW 19 39638734 missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGCATAGCAGAATCTTTCCTCATC -3'
(R):5'- AGGGAAAATATGTCTCATCTTTGTGTC -3'

Sequencing Primer
(F):5'- TCTTCATTCCACAGGGATAAAGC -3'
(R):5'- TTGTGTCTTTGCTTAACTAGATATCC -3'
Posted On 2022-03-25