Incidental Mutation 'R0751:Tnrc6a'
ID70327
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
MMRRC Submission 038931-MU
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R0751 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123170340 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 451 (N451S)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094053
AA Change: N451S

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: N451S

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205449
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205732
Predicted Effect probably benign
Transcript: ENSMUST00000205760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205789
Predicted Effect probably benign
Transcript: ENSMUST00000206014
Predicted Effect probably benign
Transcript: ENSMUST00000206888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211170
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alox12 T C 11: 70,246,950 I455V probably benign Het
Ankrd28 A G 14: 31,764,268 L89P probably damaging Het
Aqp9 A T 9: 71,138,205 C41S probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Aspm A T 1: 139,456,898 probably benign Het
Cacfd1 T C 2: 27,018,981 probably null Het
Cd33 T C 7: 43,532,121 D205G probably damaging Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chtf8 A G 8: 106,886,477 probably null Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Clock A T 5: 76,229,361 I696K possibly damaging Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Derl2 T C 11: 71,014,547 probably null Het
Dnah7c A G 1: 46,465,905 T154A probably benign Het
Dnmt3b T A 2: 153,674,842 probably null Het
Dusp3 A T 11: 101,981,728 S106T probably benign Het
Eftud2 A G 11: 102,839,253 V897A probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Fbxo33 A C 12: 59,219,092 F130V probably damaging Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fig4 T C 10: 41,272,982 D158G probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gabra2 A G 5: 71,092,099 probably benign Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Gm9268 A G 7: 43,047,409 Y630C probably damaging Het
Hkdc1 T C 10: 62,398,673 D581G probably damaging Het
Iqgap1 A G 7: 80,725,573 probably benign Het
Larp4b T C 13: 9,166,309 probably benign Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Lrrc8a T C 2: 30,256,350 V392A possibly damaging Het
Mavs A T 2: 131,246,764 Y496F probably damaging Het
Mpi A T 9: 57,550,614 S102T probably damaging Het
Mroh9 G A 1: 163,066,124 R161W possibly damaging Het
Myo1h A T 5: 114,320,686 S161C probably damaging Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Nelfcd C A 2: 174,423,014 A182D probably benign Het
Ntsr2 G T 12: 16,654,030 K91N probably damaging Het
Obscn A G 11: 59,081,819 S2134P probably damaging Het
Ogfod2 G A 5: 124,113,476 probably benign Het
Olfr385 G T 11: 73,589,144 T198K probably benign Het
Olfr525 G A 7: 140,323,325 V209I probably benign Het
Pcdha8 T C 18: 36,994,070 V535A probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pimreg C A 11: 72,043,113 Q22K probably benign Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ppip5k2 A T 1: 97,749,652 C306* probably null Het
Ptprc A G 1: 138,092,930 Y588H probably damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc12a4 A T 8: 105,951,900 V266E probably damaging Het
Slc8b1 A G 5: 120,524,195 probably benign Het
Smim4 G T 14: 31,088,996 probably benign Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Ssb T A 2: 69,870,565 S330T probably benign Het
Stard9 G T 2: 120,697,485 V1408F probably benign Het
Sumf2 A T 5: 129,850,005 T61S probably benign Het
Sypl2 T C 3: 108,216,756 T157A probably damaging Het
Tgfbr3 A T 5: 107,139,883 D483E probably damaging Het
Tradd T C 8: 105,259,771 E123G probably damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Ttc30a2 C T 2: 75,978,031 A46T probably damaging Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ubr4 C T 4: 139,437,198 probably benign Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vmn2r63 A C 7: 42,928,035 F360V probably damaging Het
Vmn2r78 G A 7: 86,954,380 V589M possibly damaging Het
Vrk2 A G 11: 26,483,331 probably benign Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0566:Tnrc6a UTSW 7 123170913 missense probably benign 0.00
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2086:Tnrc6a UTSW 7 123162446 splice site probably benign
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4439:Tnrc6a UTSW 7 123152182 nonsense probably null
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 123192090 missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 123187445 missense probably benign 0.17
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
R7500:Tnrc6a UTSW 7 123173450 splice site probably null
R7872:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
R8270:Tnrc6a UTSW 7 123170071 missense possibly damaging 0.92
R8313:Tnrc6a UTSW 7 123170713 missense possibly damaging 0.92
R8348:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
R8390:Tnrc6a UTSW 7 123162571 missense probably damaging 0.97
R8448:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
R8514:Tnrc6a UTSW 7 123184215 nonsense probably null
R8552:Tnrc6a UTSW 7 123162446 splice site probably benign
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Z1176:Tnrc6a UTSW 7 123162496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATAGGATGAATGCTTGGGGCAC -3'
(R):5'- TAGGCACCCCATGTAGTACCGTAG -3'

Sequencing Primer
(F):5'- TTCAGTGTAGTACCATAGGCCAG -3'
(R):5'- ATGTAGTACCGTAGGAGCCTC -3'
Posted On2013-09-30