Mutagenetix > Incidental Mutations

Incidental Mutation 'R0751:Tnrc6a'

70327

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6a

Ensembl Gene

ENSMUSG00000052707

Gene Name

trinucleotide repeat containing 6a

Synonyms

CAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik

MMRRC Submission

038931-MU

Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene?

Probably essential (E-score: 0.769) question?

Stock #

R0751 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123123885-123195296 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123170340 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 451 (N451S)

Ref Sequence

ENSEMBL: ENSMUSP00000091595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094053
AA Change: N451S

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: N451S

Domain	Start	End	E-Value	Type
coiled coil region	5	54	N/A	INTRINSIC
low complexity region	69	92	N/A	INTRINSIC
low complexity region	93	113	N/A	INTRINSIC
low complexity region	281	294	N/A	INTRINSIC
low complexity region	430	443	N/A	INTRINSIC
low complexity region	568	590	N/A	INTRINSIC
internal_repeat_1	690	853	3.51e-6	PROSPERO
low complexity region	858	871	N/A	INTRINSIC
Pfam:Ago_hook	1028	1190	1.2e-29	PFAM
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1301	1316	N/A	INTRINSIC
low complexity region	1337	1376	N/A	INTRINSIC
low complexity region	1386	1392	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1439	1714	1.5e-126	PFAM
RRM	1717	1784	4.95e-2	SMART
low complexity region	1808	1820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205449

Predicted Effect

probably benign
Transcript: ENSMUST00000205514

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205732

Predicted Effect

probably benign
Transcript: ENSMUST00000205760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205789

Predicted Effect

probably benign
Transcript: ENSMUST00000206014

Predicted Effect

probably benign
Transcript: ENSMUST00000206888

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206922

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211170

Meta Mutation Damage Score

0.0746

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 94.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]

Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahdc1	T	A	4: 133,065,396	M1316K	probably benign	Het
Alox12	T	C	11: 70,246,950	I455V	probably benign	Het
Ankrd28	A	G	14: 31,764,268	L89P	probably damaging	Het
Aqp9	A	T	9: 71,138,205	C41S	probably damaging	Het
Arhgap17	T	C	7: 123,314,690	Y199C	probably damaging	Het
Aspm	A	T	1: 139,456,898		probably benign	Het
Cacfd1	T	C	2: 27,018,981		probably null	Het
Cd33	T	C	7: 43,532,121	D205G	probably damaging	Het
Chadl	T	C	15: 81,693,057	S198G	probably benign	Het
Chtf8	A	G	8: 106,886,477		probably null	Het
Clec4a4	G	T	6: 123,012,712	W104L	probably benign	Het
Clock	A	T	5: 76,229,361	I696K	possibly damaging	Het
Crtc2	T	A	3: 90,262,633	Y445*	probably null	Het
Dapk1	A	T	13: 60,696,298	I44F	probably damaging	Het
Dcbld2	T	A	16: 58,449,841		probably null	Het
Derl2	T	C	11: 71,014,547		probably null	Het
Dnah7c	A	G	1: 46,465,905	T154A	probably benign	Het
Dnmt3b	T	A	2: 153,674,842		probably null	Het
Dusp3	A	T	11: 101,981,728	S106T	probably benign	Het
Eftud2	A	G	11: 102,839,253	V897A	probably damaging	Het
Eif3l	T	A	15: 79,075,766		probably null	Het
Fbxo33	A	C	12: 59,219,092	F130V	probably damaging	Het
Ffar3	T	A	7: 30,855,104	N264Y	probably damaging	Het
Fig4	T	C	10: 41,272,982	D158G	probably damaging	Het
Fyco1	A	G	9: 123,819,153	F1239L	probably damaging	Het
Gabra2	A	G	5: 71,092,099		probably benign	Het
Gabra6	C	A	11: 42,315,017	R336S	probably benign	Het
Gm9268	A	G	7: 43,047,409	Y630C	probably damaging	Het
Hkdc1	T	C	10: 62,398,673	D581G	probably damaging	Het
Iqgap1	A	G	7: 80,725,573		probably benign	Het
Larp4b	T	C	13: 9,166,309		probably benign	Het
Lcp1	A	T	14: 75,199,387	M58L	probably benign	Het
Lrrc8a	T	C	2: 30,256,350	V392A	possibly damaging	Het
Mavs	A	T	2: 131,246,764	Y496F	probably damaging	Het
Mpi	A	T	9: 57,550,614	S102T	probably damaging	Het
Mroh9	G	A	1: 163,066,124	R161W	possibly damaging	Het
Myo1h	A	T	5: 114,320,686	S161C	probably damaging	Het
Napg	T	G	18: 62,994,338	H204Q	probably benign	Het
Nelfcd	C	A	2: 174,423,014	A182D	probably benign	Het
Ntsr2	G	T	12: 16,654,030	K91N	probably damaging	Het
Obscn	A	G	11: 59,081,819	S2134P	probably damaging	Het
Ogfod2	G	A	5: 124,113,476		probably benign	Het
Olfr385	G	T	11: 73,589,144	T198K	probably benign	Het
Olfr525	G	A	7: 140,323,325	V209I	probably benign	Het
Pcdha8	T	C	18: 36,994,070	V535A	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pik3r1	T	C	13: 101,686,358		probably null	Het
Pimreg	C	A	11: 72,043,113	Q22K	probably benign	Het
Pld5	A	G	1: 176,044,896	I225T	probably damaging	Het
Plxnc1	T	C	10: 94,831,333		probably benign	Het
Ppip5k2	A	T	1: 97,749,652	C306*	probably null	Het
Ptprc	A	G	1: 138,092,930	Y588H	probably damaging	Het
Rac2	T	G	15: 78,565,945	D65A	possibly damaging	Het
Rgl3	A	G	9: 21,977,380		probably null	Het
Serpinb1a	T	C	13: 32,843,216	K248E	probably benign	Het
Serpinb9e	A	C	13: 33,259,774	E259A	probably benign	Het
Slc12a4	A	T	8: 105,951,900	V266E	probably damaging	Het
Slc8b1	A	G	5: 120,524,195		probably benign	Het
Smim4	G	T	14: 31,088,996		probably benign	Het
Spink6	T	C	18: 44,071,538		probably benign	Het
Spta1	G	A	1: 174,184,690	R354H	probably damaging	Het
Ssb	T	A	2: 69,870,565	S330T	probably benign	Het
Stard9	G	T	2: 120,697,485	V1408F	probably benign	Het
Sumf2	A	T	5: 129,850,005	T61S	probably benign	Het
Sypl2	T	C	3: 108,216,756	T157A	probably damaging	Het
Tgfbr3	A	T	5: 107,139,883	D483E	probably damaging	Het
Tradd	T	C	8: 105,259,771	E123G	probably damaging	Het
Trim36	T	C	18: 46,196,251	T41A	probably damaging	Het
Ttc30a2	C	T	2: 75,978,031	A46T	probably damaging	Het
Ttll7	C	T	3: 146,939,991	P535S	probably damaging	Het
Ubr4	C	T	4: 139,437,198		probably benign	Het
Vmn1r195	A	G	13: 22,279,011	Y217C	probably damaging	Het
Vmn2r63	A	C	7: 42,928,035	F360V	probably damaging	Het
Vmn2r78	G	A	7: 86,954,380	V589M	possibly damaging	Het
Vrk2	A	G	11: 26,483,331		probably benign	Het

Other mutations in Tnrc6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Tnrc6a	APN	7	123170780	missense	probably benign	0.04
IGL00580:Tnrc6a	APN	7	123174278	missense	probably damaging	1.00
IGL01309:Tnrc6a	APN	7	123171494	missense	probably benign	0.04
IGL02004:Tnrc6a	APN	7	123181366	missense	possibly damaging	0.57
IGL02142:Tnrc6a	APN	7	123152191	intron	probably benign
IGL02220:Tnrc6a	APN	7	123170456	missense	probably benign
IGL02436:Tnrc6a	APN	7	123184215	nonsense	probably null
IGL02670:Tnrc6a	APN	7	123171312	missense	possibly damaging	0.92
IGL02743:Tnrc6a	APN	7	123171473	missense	probably damaging	1.00
0152:Tnrc6a	UTSW	7	123180654	missense	probably damaging	1.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0369:Tnrc6a	UTSW	7	123170860	missense	probably damaging	1.00
R0512:Tnrc6a	UTSW	7	123186728	splice site	probably benign
R0566:Tnrc6a	UTSW	7	123170913	missense	probably benign	0.00
R0600:Tnrc6a	UTSW	7	123171816	missense	probably benign	0.14
R1184:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1319:Tnrc6a	UTSW	7	123184251	missense	probably benign	0.02
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1585:Tnrc6a	UTSW	7	123176875	missense	probably benign	0.08
R1709:Tnrc6a	UTSW	7	123169982	missense	probably benign	0.10
R1776:Tnrc6a	UTSW	7	123171297	missense	probably damaging	1.00
R1791:Tnrc6a	UTSW	7	123192917	missense	possibly damaging	0.47
R1807:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R1876:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2010:Tnrc6a	UTSW	7	123171046	missense	probably benign	0.26
R2086:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2089:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2511:Tnrc6a	UTSW	7	123171092	missense	probably damaging	1.00
R2830:Tnrc6a	UTSW	7	123192949	makesense	probably null
R2850:Tnrc6a	UTSW	7	123179800	missense	probably damaging	1.00
R3916:Tnrc6a	UTSW	7	123181384	missense	probably damaging	1.00
R4028:Tnrc6a	UTSW	7	123170121	missense	probably damaging	1.00
R4235:Tnrc6a	UTSW	7	123171680	missense	probably benign	0.00
R4439:Tnrc6a	UTSW	7	123152182	nonsense	probably null
R4525:Tnrc6a	UTSW	7	123179782	missense	probably benign
R4578:Tnrc6a	UTSW	7	123184221	missense	possibly damaging	0.89
R4613:Tnrc6a	UTSW	7	123184289	critical splice donor site	probably null
R4711:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R4722:Tnrc6a	UTSW	7	123192090	missense	possibly damaging	0.78
R4746:Tnrc6a	UTSW	7	123189997	missense	probably damaging	1.00
R4892:Tnrc6a	UTSW	7	123169911	missense	probably damaging	1.00
R4942:Tnrc6a	UTSW	7	123192613	missense	probably damaging	0.99
R4967:Tnrc6a	UTSW	7	123189872	missense	probably damaging	1.00
R5064:Tnrc6a	UTSW	7	123186723	critical splice donor site	probably null
R5239:Tnrc6a	UTSW	7	123186619	missense	probably benign
R5604:Tnrc6a	UTSW	7	123174236	missense	probably damaging	0.97
R5805:Tnrc6a	UTSW	7	123170076	missense	probably damaging	0.97
R5942:Tnrc6a	UTSW	7	123186665	missense	probably damaging	1.00
R5988:Tnrc6a	UTSW	7	123182380	missense	probably damaging	0.96
R6212:Tnrc6a	UTSW	7	123143742	splice site	probably null
R6284:Tnrc6a	UTSW	7	123171335	missense	probably damaging	0.99
R6417:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6420:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6575:Tnrc6a	UTSW	7	123169910	missense	probably damaging	1.00
R6760:Tnrc6a	UTSW	7	123171999	missense	probably damaging	1.00
R6886:Tnrc6a	UTSW	7	123187445	missense	probably benign	0.17
R6968:Tnrc6a	UTSW	7	123182427	missense	probably benign	0.05
R7216:Tnrc6a	UTSW	7	123171495	missense	probably benign	0.01
R7260:Tnrc6a	UTSW	7	123186590	missense	probably benign	0.36
R7299:Tnrc6a	UTSW	7	123170913	missense	probably benign
R7322:Tnrc6a	UTSW	7	123171508	missense	probably benign	0.09
R7500:Tnrc6a	UTSW	7	123173450	splice site	probably null
R7872:Tnrc6a	UTSW	7	123179834	missense	probably damaging	0.99
R8270:Tnrc6a	UTSW	7	123170071	missense	possibly damaging	0.92
R8313:Tnrc6a	UTSW	7	123170713	missense	possibly damaging	0.92
R8348:Tnrc6a	UTSW	7	123192123	missense	possibly damaging	0.65
R8390:Tnrc6a	UTSW	7	123162571	missense	probably damaging	0.97
R8448:Tnrc6a	UTSW	7	123192123	missense	possibly damaging	0.65
R8514:Tnrc6a	UTSW	7	123184215	nonsense	probably null
R8552:Tnrc6a	UTSW	7	123162446	splice site	probably benign
X0064:Tnrc6a	UTSW	7	123169798	missense	probably benign	0.28
Z1176:Tnrc6a	UTSW	7	123162496	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAATAGGATGAATGCTTGGGGCAC -3'
(R):5'- TAGGCACCCCATGTAGTACCGTAG -3'

Sequencing Primer
(F):5'- TTCAGTGTAGTACCATAGGCCAG -3'
(R):5'- ATGTAGTACCGTAGGAGCCTC -3'

Posted On

2013-09-30