Incidental Mutation 'R9276:Cfap46'
ID 703300
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9276 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139600951-139683817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139621291 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1919 (C1919S)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990]
AlphaFold E9Q2C0
Predicted Effect unknown
Transcript: ENSMUST00000129990
AA Change: C1919S
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: C1919S

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,942,688 R102S probably benign Het
Acvr2b C T 9: 119,402,550 T2M probably benign Het
Adcy7 A G 8: 88,325,386 Y894C probably damaging Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Amt C A 9: 108,301,211 T339K probably benign Het
Ankrd27 G T 7: 35,620,570 V639L probably benign Het
Anxa10 G T 8: 62,096,719 Q31K probably damaging Het
Ap1g2 T C 14: 55,102,361 T454A probably benign Het
Boll A T 1: 55,360,653 I43N possibly damaging Het
Cacna1c T C 6: 118,624,433 D1472G Het
Calcrl T C 2: 84,375,299 N16S probably benign Het
Ccdc191 C T 16: 43,943,678 Q501* probably null Het
Cchcr1 T C 17: 35,530,208 L658P probably damaging Het
Col6a3 G A 1: 90,807,681 L1356F possibly damaging Het
Dlc1 A G 8: 36,579,404 S680P possibly damaging Het
Dock4 T G 12: 40,649,405 M206R possibly damaging Het
Eml5 T C 12: 98,798,801 K1630E probably damaging Het
Fam206a A T 4: 56,806,141 K184N probably benign Het
Fat1 A G 8: 45,035,477 T3432A probably damaging Het
Fat2 G A 11: 55,256,120 P4017S probably benign Het
Fcrl5 G T 3: 87,435,831 probably benign Het
Fcrla A G 1: 170,927,566 probably benign Het
Fut4 C A 9: 14,751,276 D241Y probably benign Het
Gjc2 T C 11: 59,177,627 T10A probably damaging Het
Gle1 C T 2: 29,939,502 H203Y possibly damaging Het
Gm5565 A T 5: 146,160,107 I74N probably damaging Het
Gm5615 A T 9: 36,534,431 C75S probably damaging Het
Gnl2 T A 4: 125,053,457 I624K possibly damaging Het
Gnpat C A 8: 124,887,785 N653K probably benign Het
Gstcd A G 3: 133,071,904 L382S probably damaging Het
Jmjd7 T C 2: 120,030,414 V115A possibly damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltbp2 T G 12: 84,830,111 D440A possibly damaging Het
Macf1 T G 4: 123,434,708 D4744A probably damaging Het
Mapk11 T C 15: 89,145,169 D230G probably damaging Het
Mfsd6 A C 1: 52,708,355 Y450* probably null Het
Mtmr9 A G 14: 63,543,552 C30R probably damaging Het
Ncf1 G A 5: 134,221,839 Q376* probably null Het
Ncor2 C A 5: 125,036,086 R296M Het
Olfr1077-ps1 A T 2: 86,526,048 L43* probably null Het
Olfr1164 A G 2: 88,093,462 V158A probably benign Het
Olfr145 C A 9: 37,898,119 S238R probably benign Het
Olfr175-ps1 A G 16: 58,824,371 F113L probably benign Het
Olfr615 A T 7: 103,560,797 T107S probably damaging Het
Olfr983 A T 9: 40,092,336 I210K possibly damaging Het
Pcsk6 A T 7: 65,910,202 I92F probably damaging Het
Plec A G 15: 76,176,245 V3164A probably benign Het
Prss16 A G 13: 22,006,005 probably benign Het
Ptch2 T A 4: 117,110,308 H724Q probably damaging Het
Pzp A T 6: 128,522,114 F190Y probably damaging Het
Rab6a A G 7: 100,626,602 T41A probably benign Het
Rbm6 A G 9: 107,783,727 L879P probably damaging Het
Rnf17 T C 14: 56,482,097 S935P probably damaging Het
Ryr1 C A 7: 29,102,829 V789L probably damaging Het
Scgb2b3 A T 7: 31,360,103 M82K possibly damaging Het
Sgce T A 6: 4,674,585 L451F probably damaging Het
Slc25a17 A C 15: 81,323,613 V258G probably benign Het
Spidr G A 16: 15,966,848 T452I probably benign Het
Tas2r129 A G 6: 132,951,613 N171S probably benign Het
Tbc1d24 A T 17: 24,186,140 V10E probably damaging Het
Tdo2 T G 3: 81,969,578 M115L probably benign Het
Tdrd9 T C 12: 112,014,501 probably null Het
Tead1 T A 7: 112,894,394 I376N probably damaging Het
Tmem26 A G 10: 68,778,658 H301R possibly damaging Het
Tnxb A G 17: 34,710,160 T2726A possibly damaging Het
Trim43c T C 9: 88,841,913 M164T probably benign Het
Trpc1 G A 9: 95,708,235 S723L probably benign Het
Txndc15 A G 13: 55,718,101 D126G probably benign Het
Usp25 C T 16: 77,113,833 H926Y probably benign Het
Uvssa T A 5: 33,414,836 M700K possibly damaging Het
Vdac1 T A 11: 52,383,962 Y146N probably damaging Het
Vmn1r231 A T 17: 20,890,298 S118R probably benign Het
Vmn1r41 A G 6: 89,747,098 Y207C probably damaging Het
Vmn2r79 A G 7: 87,037,837 I809V probably damaging Het
Vnn1 G A 10: 23,900,896 G382R probably damaging Het
Xcr1 A T 9: 123,856,615 H27Q probably benign Het
Yeats2 T A 16: 20,157,036 N94K probably benign Het
Zfp28 C T 7: 6,394,441 T625M probably damaging Het
Zfp521 T C 18: 13,844,641 Q905R probably benign Het
Zfp804b T C 5: 6,771,398 D555G probably damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8912:Cfap46 UTSW 7 139680181 intron probably benign
R8920:Cfap46 UTSW 7 139652526 missense
R8977:Cfap46 UTSW 7 139679933 missense probably benign 0.01
R9048:Cfap46 UTSW 7 139627343 missense unknown
R9224:Cfap46 UTSW 7 139678500 nonsense probably null
R9252:Cfap46 UTSW 7 139618249 missense unknown
R9301:Cfap46 UTSW 7 139642545 missense
R9391:Cfap46 UTSW 7 139618111 missense unknown
R9402:Cfap46 UTSW 7 139635949 missense unknown
R9443:Cfap46 UTSW 7 139615107 missense
R9564:Cfap46 UTSW 7 139651555 missense not run
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTATCTGCACCAAGGTGTG -3'
(R):5'- TGCCTTGTCAAAGTACTTGCC -3'

Sequencing Primer
(F):5'- TGGTTGGGTCCCACAGATTCAC -3'
(R):5'- CAATAGCTGCTCTCCTTGGGAAG -3'
Posted On 2022-03-25