Incidental Mutation 'R9276:Eml5'
ID 703325
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock # R9276 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 98786805-98901484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98798801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1630 (K1630E)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably damaging
Transcript: ENSMUST00000065716
AA Change: K1583E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: K1583E

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222097
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: K1630E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,942,688 R102S probably benign Het
Acvr2b C T 9: 119,402,550 T2M probably benign Het
Adcy7 A G 8: 88,325,386 Y894C probably damaging Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Amt C A 9: 108,301,211 T339K probably benign Het
Ankrd27 G T 7: 35,620,570 V639L probably benign Het
Anxa10 G T 8: 62,096,719 Q31K probably damaging Het
Ap1g2 T C 14: 55,102,361 T454A probably benign Het
Boll A T 1: 55,360,653 I43N possibly damaging Het
Cacna1c T C 6: 118,624,433 D1472G Het
Calcrl T C 2: 84,375,299 N16S probably benign Het
Ccdc191 C T 16: 43,943,678 Q501* probably null Het
Cchcr1 T C 17: 35,530,208 L658P probably damaging Het
Cfap46 A T 7: 139,621,291 C1919S unknown Het
Col6a3 G A 1: 90,807,681 L1356F possibly damaging Het
Dlc1 A G 8: 36,579,404 S680P possibly damaging Het
Dock4 T G 12: 40,649,405 M206R possibly damaging Het
Fam206a A T 4: 56,806,141 K184N probably benign Het
Fat1 A G 8: 45,035,477 T3432A probably damaging Het
Fat2 G A 11: 55,256,120 P4017S probably benign Het
Fcrl5 G T 3: 87,435,831 probably benign Het
Fcrla A G 1: 170,927,566 probably benign Het
Fut4 C A 9: 14,751,276 D241Y probably benign Het
Gjc2 T C 11: 59,177,627 T10A probably damaging Het
Gle1 C T 2: 29,939,502 H203Y possibly damaging Het
Gm5565 A T 5: 146,160,107 I74N probably damaging Het
Gm5615 A T 9: 36,534,431 C75S probably damaging Het
Gnl2 T A 4: 125,053,457 I624K possibly damaging Het
Gnpat C A 8: 124,887,785 N653K probably benign Het
Gstcd A G 3: 133,071,904 L382S probably damaging Het
Jmjd7 T C 2: 120,030,414 V115A possibly damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltbp2 T G 12: 84,830,111 D440A possibly damaging Het
Macf1 T G 4: 123,434,708 D4744A probably damaging Het
Mapk11 T C 15: 89,145,169 D230G probably damaging Het
Mfsd6 A C 1: 52,708,355 Y450* probably null Het
Mtmr9 A G 14: 63,543,552 C30R probably damaging Het
Ncf1 G A 5: 134,221,839 Q376* probably null Het
Ncor2 C A 5: 125,036,086 R296M Het
Olfr1077-ps1 A T 2: 86,526,048 L43* probably null Het
Olfr1164 A G 2: 88,093,462 V158A probably benign Het
Olfr145 C A 9: 37,898,119 S238R probably benign Het
Olfr175-ps1 A G 16: 58,824,371 F113L probably benign Het
Olfr615 A T 7: 103,560,797 T107S probably damaging Het
Olfr983 A T 9: 40,092,336 I210K possibly damaging Het
Pcsk6 A T 7: 65,910,202 I92F probably damaging Het
Plec A G 15: 76,176,245 V3164A probably benign Het
Prss16 A G 13: 22,006,005 probably benign Het
Ptch2 T A 4: 117,110,308 H724Q probably damaging Het
Pzp A T 6: 128,522,114 F190Y probably damaging Het
Rab6a A G 7: 100,626,602 T41A probably benign Het
Rbm6 A G 9: 107,783,727 L879P probably damaging Het
Rnf17 T C 14: 56,482,097 S935P probably damaging Het
Ryr1 C A 7: 29,102,829 V789L probably damaging Het
Scgb2b3 A T 7: 31,360,103 M82K possibly damaging Het
Sgce T A 6: 4,674,585 L451F probably damaging Het
Slc25a17 A C 15: 81,323,613 V258G probably benign Het
Spidr G A 16: 15,966,848 T452I probably benign Het
Tas2r129 A G 6: 132,951,613 N171S probably benign Het
Tbc1d24 A T 17: 24,186,140 V10E probably damaging Het
Tdo2 T G 3: 81,969,578 M115L probably benign Het
Tdrd9 T C 12: 112,014,501 probably null Het
Tead1 T A 7: 112,894,394 I376N probably damaging Het
Tmem26 A G 10: 68,778,658 H301R possibly damaging Het
Tnxb A G 17: 34,710,160 T2726A possibly damaging Het
Trim43c T C 9: 88,841,913 M164T probably benign Het
Trpc1 G A 9: 95,708,235 S723L probably benign Het
Txndc15 A G 13: 55,718,101 D126G probably benign Het
Usp25 C T 16: 77,113,833 H926Y probably benign Het
Uvssa T A 5: 33,414,836 M700K possibly damaging Het
Vdac1 T A 11: 52,383,962 Y146N probably damaging Het
Vmn1r231 A T 17: 20,890,298 S118R probably benign Het
Vmn1r41 A G 6: 89,747,098 Y207C probably damaging Het
Vmn2r79 A G 7: 87,037,837 I809V probably damaging Het
Vnn1 G A 10: 23,900,896 G382R probably damaging Het
Xcr1 A T 9: 123,856,615 H27Q probably benign Het
Yeats2 T A 16: 20,157,036 N94K probably benign Het
Zfp28 C T 7: 6,394,441 T625M probably damaging Het
Zfp521 T C 18: 13,844,641 Q905R probably benign Het
Zfp804b T C 5: 6,771,398 D555G probably damaging Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
BB010:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
R7842:Eml5 UTSW 12 98794135 missense probably damaging 1.00
R7933:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98792514 critical splice donor site probably null
R8198:Eml5 UTSW 12 98858886 nonsense probably null
R8482:Eml5 UTSW 12 98876301 missense probably damaging 1.00
R8732:Eml5 UTSW 12 98815959 missense probably damaging 0.99
R8956:Eml5 UTSW 12 98852693 missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98810570 missense probably damaging 0.99
R9131:Eml5 UTSW 12 98858840 missense probably damaging 1.00
R9258:Eml5 UTSW 12 98844117 missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98856028 missense probably damaging 0.99
R9301:Eml5 UTSW 12 98882033 nonsense probably null
R9368:Eml5 UTSW 12 98796578 missense probably benign 0.31
R9392:Eml5 UTSW 12 98900940 missense probably damaging 1.00
R9393:Eml5 UTSW 12 98876174 missense probably benign 0.35
R9449:Eml5 UTSW 12 98861295 missense probably damaging 1.00
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TAGAACCCTGGCTGCAGTTC -3'
(R):5'- GCGAGCTCTCTTTGAACTTTTG -3'

Sequencing Primer
(F):5'- GTTTGGCCTCAATGCACACAG -3'
(R):5'- CGAGCTCTCTTTGAACTTTTGATGAG -3'
Posted On 2022-03-25