Incidental Mutation 'R9276:Ccdc191'
ID 703337
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock # R9276 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 43889800-43964314 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 43943678 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 501 (Q501*)
Ref Sequence ENSEMBL: ENSMUSP00000137597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect probably null
Transcript: ENSMUST00000122440
AA Change: Q86*
SMART Domains Protein: ENSMUSP00000113814
Gene: ENSMUSG00000022701
AA Change: Q86*

DomainStartEndE-ValueType
coiled coil region 114 147 N/A INTRINSIC
coiled coil region 211 284 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132859
AA Change: Q443*
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: Q443*

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178400
AA Change: Q501*
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: Q501*

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,942,688 R102S probably benign Het
Acvr2b C T 9: 119,402,550 T2M probably benign Het
Adamtsl3 A G 7: 82,557,502 probably benign Het
Adcy7 A G 8: 88,325,386 Y894C probably damaging Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Amt C A 9: 108,301,211 T339K probably benign Het
Ankrd27 G T 7: 35,620,570 V639L probably benign Het
Anxa10 G T 8: 62,096,719 Q31K probably damaging Het
Ap1g2 T C 14: 55,102,361 T454A probably benign Het
Boll A T 1: 55,360,653 I43N possibly damaging Het
Cacna1c T C 6: 118,624,433 D1472G Het
Calcrl T C 2: 84,375,299 N16S probably benign Het
Cchcr1 T C 17: 35,530,208 L658P probably damaging Het
Cfap46 A T 7: 139,621,291 C1919S unknown Het
Col6a3 G A 1: 90,807,681 L1356F possibly damaging Het
Dlc1 A G 8: 36,579,404 S680P possibly damaging Het
Dock4 T G 12: 40,649,405 M206R possibly damaging Het
Eml5 T C 12: 98,798,801 K1630E probably damaging Het
Fam206a A T 4: 56,806,141 K184N probably benign Het
Fat1 A G 8: 45,035,477 T3432A probably damaging Het
Fcrl5 G T 3: 87,435,831 probably benign Het
Fcrla A G 1: 170,927,566 probably benign Het
Fut4 C A 9: 14,751,276 D241Y probably benign Het
Fzd6 A G 15: 39,007,567 probably benign Het
Gjc2 T C 11: 59,177,627 T10A probably damaging Het
Gle1 C T 2: 29,939,502 H203Y possibly damaging Het
Gm5565 A T 5: 146,160,107 I74N probably damaging Het
Gm5615 A T 9: 36,534,431 C75S probably damaging Het
Gnl2 T A 4: 125,053,457 I624K possibly damaging Het
Gnpat C A 8: 124,887,785 N653K probably benign Het
Gstcd A G 3: 133,071,904 L382S probably damaging Het
Ipcef1 A G 10: 6,907,936 probably benign Het
Jmjd7 T C 2: 120,030,414 V115A possibly damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltbp2 T G 12: 84,830,111 D440A possibly damaging Het
Macf1 T G 4: 123,434,708 D4744A probably damaging Het
Mapk11 T C 15: 89,145,169 D230G probably damaging Het
Mfsd6 A C 1: 52,708,355 Y450* probably null Het
Mtmr9 A G 14: 63,543,552 C30R probably damaging Het
Ncf1 G A 5: 134,221,839 Q376* probably null Het
Ncor2 C A 5: 125,036,086 R296M Het
Olfr1077-ps1 A T 2: 86,526,048 L43* probably null Het
Olfr1164 A G 2: 88,093,462 V158A probably benign Het
Olfr145 C A 9: 37,898,119 S238R probably benign Het
Olfr175-ps1 A G 16: 58,824,371 F113L probably benign Het
Olfr615 A T 7: 103,560,797 T107S probably damaging Het
Olfr983 A T 9: 40,092,336 I210K possibly damaging Het
Pcsk6 A T 7: 65,910,202 I92F probably damaging Het
Plec A G 15: 76,176,245 V3164A probably benign Het
Prss16 A G 13: 22,006,005 probably benign Het
Ptch2 T A 4: 117,110,308 H724Q probably damaging Het
Pzp A T 6: 128,522,114 F190Y probably damaging Het
Rab6a A G 7: 100,626,602 T41A probably benign Het
Rbm6 A G 9: 107,783,727 L879P probably damaging Het
Rem1 T A 2: 152,628,049 probably benign Het
Rnf17 T C 14: 56,482,097 S935P probably damaging Het
Ryr1 C A 7: 29,102,829 V789L probably damaging Het
Scgb2b3 A T 7: 31,360,103 M82K possibly damaging Het
Sgce T A 6: 4,674,585 L451F probably damaging Het
Slc25a17 A C 15: 81,323,613 V258G probably benign Het
Spidr G A 16: 15,966,848 T452I probably benign Het
Tas2r129 A G 6: 132,951,613 N171S probably benign Het
Tbc1d24 A T 17: 24,186,140 V10E probably damaging Het
Tdo2 T G 3: 81,969,578 M115L probably benign Het
Tdrd9 T C 12: 112,014,501 probably null Het
Tead1 T A 7: 112,894,394 I376N probably damaging Het
Tmem26 A G 10: 68,778,658 H301R possibly damaging Het
Tnxb A G 17: 34,710,160 T2726A possibly damaging Het
Trim43c T C 9: 88,841,913 M164T probably benign Het
Trpc1 G A 9: 95,708,235 S723L probably benign Het
Txndc15 A G 13: 55,718,101 D126G probably benign Het
Urb1 C T 16: 90,772,575 probably benign Het
Usp25 C T 16: 77,113,833 H926Y probably benign Het
Uvssa T A 5: 33,414,836 M700K possibly damaging Het
Vdac1 T A 11: 52,383,962 Y146N probably damaging Het
Vmn1r231 A T 17: 20,890,298 S118R probably benign Het
Vmn1r41 A G 6: 89,747,098 Y207C probably damaging Het
Vmn2r79 A G 7: 87,037,837 I809V probably damaging Het
Vnn1 G A 10: 23,900,896 G382R probably damaging Het
Xcr1 A T 9: 123,856,615 H27Q probably benign Het
Yeats2 T A 16: 20,157,036 N94K probably benign Het
Zfp28 C T 7: 6,394,441 T625M probably damaging Het
Zfp521 T C 18: 13,844,641 Q905R probably benign Het
Zfp804b T C 5: 6,771,398 D555G probably damaging Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43959300 missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43960022 missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43956894 missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43960099 missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43921801 intron probably benign
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0346:Ccdc191 UTSW 16 43938952 missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43931341 nonsense probably null
R0907:Ccdc191 UTSW 16 43915538 missense probably benign 0.03
R0930:Ccdc191 UTSW 16 43931255 missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43943510 missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43908635 missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43931198 missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43943967 splice site probably null
R3104:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43931283 missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43939173 splice site probably benign
R4788:Ccdc191 UTSW 16 43956822 missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43943505 missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43908613 missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43915485 missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43947457 nonsense probably null
R7543:Ccdc191 UTSW 16 43898209 nonsense probably null
R7843:Ccdc191 UTSW 16 43959336 missense probably damaging 1.00
R8077:Ccdc191 UTSW 16 43915605 critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43889899 start gained probably benign
R8984:Ccdc191 UTSW 16 43890218 intron probably benign
R8987:Ccdc191 UTSW 16 43931347 missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43898149 missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43905468 missense probably damaging 1.00
R9448:Ccdc191 UTSW 16 43938975 missense
R9507:Ccdc191 UTSW 16 43943829 missense probably damaging 0.99
R9757:Ccdc191 UTSW 16 43941807 missense
Z1177:Ccdc191 UTSW 16 43939122 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATACCAGTGAGACCACAGCAGG -3'
(R):5'- AGCGCTGGTTTTCCTTTAGC -3'

Sequencing Primer
(F):5'- GCAGGAGCTTGTCTCATCAG -3'
(R):5'- AGCTTCTGAATGGTTTTCTGC -3'
Posted On 2022-03-25