Incidental Mutation 'R9276:Vmn1r231'
ID 703341
Institutional Source Beutler Lab
Gene Symbol Vmn1r231
Ensembl Gene ENSMUSG00000050933
Gene Name vomeronasal 1 receptor 231
Synonyms V1re7
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9276 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21109978-21110913 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21110560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 118 (S118R)
Ref Sequence ENSEMBL: ENSMUSP00000056228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061278]
AlphaFold Q8R2A3
Predicted Effect probably benign
Transcript: ENSMUST00000061278
AA Change: S118R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056228
Gene: ENSMUSG00000050933
AA Change: S118R

DomainStartEndE-ValueType
Pfam:TAS2R 6 294 1.6e-13 PFAM
Pfam:V1R 36 297 1.6e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,819,887 (GRCm39) R102S probably benign Het
Abitram A T 4: 56,806,141 (GRCm39) K184N probably benign Het
Acvr2b C T 9: 119,231,616 (GRCm39) T2M probably benign Het
Adamtsl3 A G 7: 82,206,710 (GRCm39) probably benign Het
Adcy7 A G 8: 89,052,014 (GRCm39) Y894C probably damaging Het
Afdn T A 17: 14,024,270 (GRCm39) C59S probably damaging Het
Amt C A 9: 108,178,410 (GRCm39) T339K probably benign Het
Ankrd27 G T 7: 35,319,995 (GRCm39) V639L probably benign Het
Anxa10 G T 8: 62,549,753 (GRCm39) Q31K probably damaging Het
Ap1g2 T C 14: 55,339,818 (GRCm39) T454A probably benign Het
Boll A T 1: 55,399,812 (GRCm39) I43N possibly damaging Het
Cacna1c T C 6: 118,601,394 (GRCm39) D1472G Het
Calcrl T C 2: 84,205,643 (GRCm39) N16S probably benign Het
Ccdc191 C T 16: 43,764,041 (GRCm39) Q501* probably null Het
Cchcr1 T C 17: 35,841,105 (GRCm39) L658P probably damaging Het
Cfap46 A T 7: 139,201,207 (GRCm39) C1919S unknown Het
Col6a3 G A 1: 90,735,403 (GRCm39) L1356F possibly damaging Het
Dlc1 A G 8: 37,046,558 (GRCm39) S680P possibly damaging Het
Dock4 T G 12: 40,699,404 (GRCm39) M206R possibly damaging Het
Eml5 T C 12: 98,765,060 (GRCm39) K1630E probably damaging Het
Fat1 A G 8: 45,488,514 (GRCm39) T3432A probably damaging Het
Fcrl5 G T 3: 87,343,138 (GRCm39) probably benign Het
Fcrla A G 1: 170,755,135 (GRCm39) probably benign Het
Fut4 C A 9: 14,662,572 (GRCm39) D241Y probably benign Het
Fzd6 A G 15: 38,870,962 (GRCm39) probably benign Het
Gjc2 T C 11: 59,068,453 (GRCm39) T10A probably damaging Het
Gle1 C T 2: 29,829,514 (GRCm39) H203Y possibly damaging Het
Gm5565 A T 5: 146,096,917 (GRCm39) I74N probably damaging Het
Gnl2 T A 4: 124,947,250 (GRCm39) I624K possibly damaging Het
Gnpat C A 8: 125,614,524 (GRCm39) N653K probably benign Het
Gstcd A G 3: 132,777,665 (GRCm39) L382S probably damaging Het
Ipcef1 A G 10: 6,857,936 (GRCm39) probably benign Het
Jmjd7 T C 2: 119,860,895 (GRCm39) V115A possibly damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltbp2 T G 12: 84,876,885 (GRCm39) D440A possibly damaging Het
Macf1 T G 4: 123,328,501 (GRCm39) D4744A probably damaging Het
Mapk11 T C 15: 89,029,372 (GRCm39) D230G probably damaging Het
Mfsd6 A C 1: 52,747,514 (GRCm39) Y450* probably null Het
Mtmr9 A G 14: 63,781,001 (GRCm39) C30R probably damaging Het
Ncf1 G A 5: 134,250,693 (GRCm39) Q376* probably null Het
Ncor2 C A 5: 125,113,150 (GRCm39) R296M Het
Or51ah3 A T 7: 103,210,004 (GRCm39) T107S probably damaging Het
Or5d37 A G 2: 87,923,806 (GRCm39) V158A probably benign Het
Or5k8 A G 16: 58,644,734 (GRCm39) F113L probably benign Het
Or8b57 A T 9: 40,003,632 (GRCm39) I210K possibly damaging Het
Or8b8 C A 9: 37,809,415 (GRCm39) S238R probably benign Het
Or8k31-ps1 A T 2: 86,356,392 (GRCm39) L43* probably null Het
Pate9 A T 9: 36,445,727 (GRCm39) C75S probably damaging Het
Pcsk6 A T 7: 65,559,950 (GRCm39) I92F probably damaging Het
Plec A G 15: 76,060,445 (GRCm39) V3164A probably benign Het
Prss16 A G 13: 22,190,175 (GRCm39) probably benign Het
Ptch2 T A 4: 116,967,505 (GRCm39) H724Q probably damaging Het
Pzp A T 6: 128,499,077 (GRCm39) F190Y probably damaging Het
Rab6a A G 7: 100,275,809 (GRCm39) T41A probably benign Het
Rbm6 A G 9: 107,660,926 (GRCm39) L879P probably damaging Het
Rem1 T A 2: 152,469,969 (GRCm39) probably benign Het
Rnf17 T C 14: 56,719,554 (GRCm39) S935P probably damaging Het
Ryr1 C A 7: 28,802,254 (GRCm39) V789L probably damaging Het
Scgb2b3 A T 7: 31,059,528 (GRCm39) M82K possibly damaging Het
Sgce T A 6: 4,674,585 (GRCm39) L451F probably damaging Het
Slc25a17 A C 15: 81,207,814 (GRCm39) V258G probably benign Het
Spidr G A 16: 15,784,712 (GRCm39) T452I probably benign Het
Tas2r129 A G 6: 132,928,576 (GRCm39) N171S probably benign Het
Tbc1d24 A T 17: 24,405,114 (GRCm39) V10E probably damaging Het
Tdo2 T G 3: 81,876,885 (GRCm39) M115L probably benign Het
Tdrd9 T C 12: 111,980,935 (GRCm39) probably null Het
Tead1 T A 7: 112,493,601 (GRCm39) I376N probably damaging Het
Tmem26 A G 10: 68,614,488 (GRCm39) H301R possibly damaging Het
Tnxb A G 17: 34,929,134 (GRCm39) T2726A possibly damaging Het
Trim43c T C 9: 88,723,966 (GRCm39) M164T probably benign Het
Trpc1 G A 9: 95,590,288 (GRCm39) S723L probably benign Het
Txndc15 A G 13: 55,865,914 (GRCm39) D126G probably benign Het
Urb1 C T 16: 90,569,463 (GRCm39) probably benign Het
Usp25 C T 16: 76,910,721 (GRCm39) H926Y probably benign Het
Uvssa T A 5: 33,572,180 (GRCm39) M700K possibly damaging Het
Vdac1 T A 11: 52,274,789 (GRCm39) Y146N probably damaging Het
Vmn1r41 A G 6: 89,724,080 (GRCm39) Y207C probably damaging Het
Vmn2r79 A G 7: 86,687,045 (GRCm39) I809V probably damaging Het
Vnn1 G A 10: 23,776,794 (GRCm39) G382R probably damaging Het
Xcr1 A T 9: 123,685,680 (GRCm39) H27Q probably benign Het
Yeats2 T A 16: 19,975,786 (GRCm39) N94K probably benign Het
Zfp28 C T 7: 6,397,440 (GRCm39) T625M probably damaging Het
Zfp521 T C 18: 13,977,698 (GRCm39) Q905R probably benign Het
Zfp804b T C 5: 6,821,398 (GRCm39) D555G probably damaging Het
Other mutations in Vmn1r231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r231 APN 17 21,110,828 (GRCm39) missense possibly damaging 0.68
IGL02124:Vmn1r231 APN 17 21,110,568 (GRCm39) missense probably damaging 1.00
IGL02151:Vmn1r231 APN 17 21,109,997 (GRCm39) missense probably benign 0.06
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0396:Vmn1r231 UTSW 17 21,110,661 (GRCm39) missense probably damaging 0.98
R0427:Vmn1r231 UTSW 17 21,110,490 (GRCm39) missense probably benign 0.05
R0470:Vmn1r231 UTSW 17 21,110,265 (GRCm39) nonsense probably null
R0848:Vmn1r231 UTSW 17 21,110,433 (GRCm39) missense probably damaging 1.00
R1692:Vmn1r231 UTSW 17 21,110,871 (GRCm39) missense probably benign 0.02
R1987:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R1988:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R2105:Vmn1r231 UTSW 17 21,110,380 (GRCm39) missense possibly damaging 0.66
R4440:Vmn1r231 UTSW 17 21,110,718 (GRCm39) missense possibly damaging 0.48
R4634:Vmn1r231 UTSW 17 21,110,660 (GRCm39) missense possibly damaging 0.46
R4646:Vmn1r231 UTSW 17 21,110,571 (GRCm39) missense probably damaging 1.00
R4678:Vmn1r231 UTSW 17 21,110,489 (GRCm39) missense possibly damaging 0.94
R4696:Vmn1r231 UTSW 17 21,110,901 (GRCm39) missense possibly damaging 0.63
R4938:Vmn1r231 UTSW 17 21,110,613 (GRCm39) missense possibly damaging 0.76
R5544:Vmn1r231 UTSW 17 21,110,840 (GRCm39) missense probably damaging 1.00
R5942:Vmn1r231 UTSW 17 21,110,417 (GRCm39) missense possibly damaging 0.83
R6053:Vmn1r231 UTSW 17 21,110,081 (GRCm39) missense probably damaging 1.00
R6692:Vmn1r231 UTSW 17 21,110,745 (GRCm39) missense possibly damaging 0.46
R6712:Vmn1r231 UTSW 17 21,109,992 (GRCm39) missense possibly damaging 0.54
R7131:Vmn1r231 UTSW 17 21,110,140 (GRCm39) missense possibly damaging 0.87
R7854:Vmn1r231 UTSW 17 21,110,894 (GRCm39) missense probably damaging 0.98
R7918:Vmn1r231 UTSW 17 21,110,236 (GRCm39) nonsense probably null
R8187:Vmn1r231 UTSW 17 21,110,893 (GRCm39) missense probably benign 0.10
R8238:Vmn1r231 UTSW 17 21,110,640 (GRCm39) missense probably benign 0.08
R8313:Vmn1r231 UTSW 17 21,110,289 (GRCm39) missense probably benign 0.02
R8525:Vmn1r231 UTSW 17 21,110,001 (GRCm39) missense probably benign 0.06
RF010:Vmn1r231 UTSW 17 21,110,255 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTGTAAATTCATCATGACC -3'
(R):5'- CTTCAATGTTCAGTGGGAATTCTG -3'

Sequencing Primer
(F):5'- GCCTGTAAATTCATCATGACCTAAAC -3'
(R):5'- GAACATGTTCATAGCCAACTTCTTC -3'
Posted On 2022-03-25