Incidental Mutation 'R9277:Clip2'
ID 703362
Institutional Source Beutler Lab
Gene Symbol Clip2
Ensembl Gene ENSMUSG00000063146
Gene Name CAP-GLY domain containing linker protein 2
Synonyms WSCR4, Cyln2, CLIP-115
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock # R9277 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 134489383-134552434 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134500109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 822 (M822T)
Ref Sequence ENSEMBL: ENSMUSP00000098212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]
AlphaFold Q9Z0H8
Predicted Effect probably benign
Transcript: ENSMUST00000036999
AA Change: M787T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: M787T

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 457 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
coiled coil region 529 578 N/A INTRINSIC
coiled coil region 640 982 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100647
AA Change: M822T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: M822T

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 496 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
coiled coil region 564 613 N/A INTRINSIC
coiled coil region 675 1017 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,976,521 Y237C probably damaging Het
Adam12 T C 7: 133,919,832 S566G probably benign Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Apob A T 12: 8,011,183 I3222F probably benign Het
Cdyl A G 13: 35,858,239 D420G probably benign Het
Cela1 C A 15: 100,683,013 A121S possibly damaging Het
Coq8a G A 1: 180,179,211 T84I probably benign Het
Dars2 G A 1: 161,049,957 A390V probably benign Het
Dhx40 C T 11: 86,770,230 M744I probably benign Het
Dnajc14 A G 10: 128,806,820 I204V probably benign Het
Eftud2 A C 11: 102,860,029 F322V probably damaging Het
Eif4g2 G A 7: 111,074,859 A646V probably damaging Het
Faim2 T C 15: 99,521,216 T91A probably benign Het
Fam160a1 C A 3: 85,672,258 R880L probably benign Het
Fancl A T 11: 26,468,847 I290F possibly damaging Het
Fermt3 A T 19: 7,013,877 Y253N possibly damaging Het
Frem3 T A 8: 80,690,773 S2036T probably damaging Het
Gm10330 A T 12: 23,779,910 V90E probably damaging Het
Gm3147 T C 5: 94,614,984 T60A probably benign Het
Gm6509 A G 5: 94,624,058 T16A probably benign Het
Golga1 T C 2: 39,024,243 E488G probably benign Het
Gpatch11 T A 17: 78,841,017 L128Q possibly damaging Het
Hoxd9 A G 2: 74,699,195 N265S possibly damaging Het
Igfn1 C T 1: 135,959,782 V2515M probably damaging Het
Itga2b A G 11: 102,461,156 L505P probably damaging Het
Klrg2 A G 6: 38,636,556 S171P probably benign Het
Lamtor5 A G 3: 107,279,088 T58A probably benign Het
Lgr6 G T 1: 134,987,479 C787* probably null Het
Madd A G 2: 91,175,710 F380S probably damaging Het
Magi1 A T 6: 93,943,253 H127Q possibly damaging Het
Maml2 A G 9: 13,620,576 E362G Het
Mfsd7a G T 5: 108,441,998 P513T probably benign Het
Morc2b C T 17: 33,136,023 G925D probably benign Het
Nalcn C T 14: 123,281,111 R1672H probably damaging Het
Npsr1 A G 9: 24,313,197 Y290C possibly damaging Het
Obox5 A T 7: 15,757,952 E97D probably damaging Het
Parn C T 16: 13,664,655 probably null Het
Pip4k2b A T 11: 97,722,446 N241K probably damaging Het
Pkn2 A G 3: 142,810,748 V539A probably benign Het
Plpp7 A T 2: 32,095,812 M1L probably damaging Het
Prtg G A 9: 72,809,647 S90N probably benign Het
Rgs7bp G A 13: 104,964,110 T219M probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scgb1b20 G A 7: 33,373,573 D69N probably benign Het
Setd2 A G 9: 110,550,551 T1145A probably damaging Het
Tmem145 A G 7: 25,309,740 Q359R probably benign Het
Trmt5 C A 12: 73,282,674 D237Y probably damaging Het
Vmn1r169 A T 7: 23,577,965 I261F probably benign Het
Vmn1r19 A T 6: 57,405,337 I292F unknown Het
Vmn2r66 T C 7: 85,011,956 D22G probably benign Het
Vwa3b T A 1: 37,157,453 probably null Het
Wbp4 T A 14: 79,476,913 D53V probably benign Het
Xpo1 A G 11: 23,291,550 I866V probably benign Het
Zan G A 5: 137,463,992 P975L unknown Het
Zdhhc19 G A 16: 32,497,694 R89Q probably benign Het
Zer1 G A 2: 30,111,285 T69I probably benign Het
Zfp827 C T 8: 79,060,400 T65I probably damaging Het
Zswim9 A G 7: 13,261,057 F391S probably damaging Het
Other mutations in Clip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Clip2 APN 5 134500157 splice site probably benign
IGL01024:Clip2 APN 5 134510212 missense probably damaging 1.00
IGL01103:Clip2 APN 5 134492350 missense possibly damaging 0.64
IGL01726:Clip2 APN 5 134522664 missense probably damaging 1.00
IGL01833:Clip2 APN 5 134498084 splice site probably benign
IGL02174:Clip2 APN 5 134494264 missense probably damaging 1.00
IGL02232:Clip2 APN 5 134503130 missense probably damaging 1.00
IGL02271:Clip2 APN 5 134502571 missense probably benign 0.35
IGL02471:Clip2 APN 5 134518022 missense probably benign 0.04
IGL02690:Clip2 APN 5 134510159 splice site probably benign
IGL03198:Clip2 APN 5 134498082 splice site probably benign
IGL03269:Clip2 APN 5 134516894 missense probably damaging 1.00
scissors UTSW 5 134517999 nonsense probably null
R0335:Clip2 UTSW 5 134535215 start gained probably benign
R0422:Clip2 UTSW 5 134498113 missense probably benign 0.04
R0519:Clip2 UTSW 5 134516151 missense probably benign 0.01
R1169:Clip2 UTSW 5 134492250 missense probably benign 0.36
R1642:Clip2 UTSW 5 134503253 missense possibly damaging 0.89
R1718:Clip2 UTSW 5 134502929 nonsense probably null
R1822:Clip2 UTSW 5 134503227 missense probably benign 0.01
R1824:Clip2 UTSW 5 134503227 missense probably benign 0.01
R2011:Clip2 UTSW 5 134503115 missense probably damaging 1.00
R3106:Clip2 UTSW 5 134523064 missense probably benign 0.12
R3890:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3891:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3892:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R4134:Clip2 UTSW 5 134492253 missense probably benign 0.08
R4237:Clip2 UTSW 5 134535197 start gained probably benign
R4239:Clip2 UTSW 5 134535197 start gained probably benign
R4294:Clip2 UTSW 5 134492313 missense probably benign 0.09
R4450:Clip2 UTSW 5 134502953 missense possibly damaging 0.82
R4741:Clip2 UTSW 5 134516269 missense probably benign 0.02
R5186:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5235:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5409:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5410:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5448:Clip2 UTSW 5 134514048 missense probably benign 0.01
R5900:Clip2 UTSW 5 134502779 missense possibly damaging 0.48
R6464:Clip2 UTSW 5 134491925 missense probably benign 0.00
R7032:Clip2 UTSW 5 134522630 missense probably damaging 1.00
R7152:Clip2 UTSW 5 134496241 missense probably damaging 1.00
R7216:Clip2 UTSW 5 134502917 missense probably benign 0.01
R7358:Clip2 UTSW 5 134502630 nonsense probably null
R7725:Clip2 UTSW 5 134517999 nonsense probably null
R8380:Clip2 UTSW 5 134502797 missense probably damaging 0.96
R8680:Clip2 UTSW 5 134502608 missense probably benign
R9095:Clip2 UTSW 5 134503400 missense possibly damaging 0.93
R9158:Clip2 UTSW 5 134492397 missense probably benign 0.00
R9300:Clip2 UTSW 5 134498088 critical splice donor site probably null
R9457:Clip2 UTSW 5 134502730 missense probably benign 0.00
R9491:Clip2 UTSW 5 134504762 missense probably benign 0.04
X0062:Clip2 UTSW 5 134503136 missense probably benign 0.12
Z1177:Clip2 UTSW 5 134516835 missense probably damaging 0.98
Z1177:Clip2 UTSW 5 134522999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCCAGGTATGAAGGTGGTTC -3'
(R):5'- TTACAAGGCAGCTGGAAGC -3'

Sequencing Primer
(F):5'- TGGTTCTTGAATCTCGGATATACC -3'
(R):5'- CTTTTCTCAAGGAGAGGGATCC -3'
Posted On 2022-03-25