Incidental Mutation 'R9277:Eif4g2'
ID 703374
Institutional Source Beutler Lab
Gene Symbol Eif4g2
Ensembl Gene ENSMUSG00000005610
Gene Name eukaryotic translation initiation factor 4, gamma 2
Synonyms DAP-5, Nat1, E130105L11Rik, Natm1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9277 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 111067750-111083030 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 111074859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 646 (A646V)
Ref Sequence ENSEMBL: ENSMUSP00000124551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159305] [ENSMUST00000160132] [ENSMUST00000161051] [ENSMUST00000162415]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000159305
SMART Domains Protein: ENSMUSP00000125098
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
Blast:MIF4G 32 83 4e-22 BLAST
SCOP:d1hu3a_ 67 102 9e-13 SMART
PDB:4IUL|B 70 102 3e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160132
SMART Domains Protein: ENSMUSP00000124914
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
Pfam:MIF4G 78 152 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161051
AA Change: A608V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125375
Gene: ENSMUSG00000005610
AA Change: A608V

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
MA3 505 618 4.76e-35 SMART
low complexity region 634 646 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 760 771 N/A INTRINSIC
eIF5C 775 861 5.43e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162415
AA Change: A646V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124551
Gene: ENSMUSG00000005610
AA Change: A646V

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
low complexity region 441 453 N/A INTRINSIC
Blast:MIF4G 454 490 4e-14 BLAST
MA3 543 656 4.76e-35 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 798 809 N/A INTRINSIC
eIF5C 813 899 5.43e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163014
SMART Domains Protein: ENSMUSP00000123811
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:W2 52 122 2.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G, that contains the binding sites for eIF4A and eIF3; eIF4G in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. Transgene expression of the apolipoprotein B mRNA-editing enzyme (APOBEC-1) causes extensive editing of this mRNA, which could contribute to the potent oncogenesis induced by overexpression of APOBEC-1. In vitro and in vivo studies in human indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. This also appears to be true for mouse. Two alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation fail to undergo gastrulation and die by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,976,521 Y237C probably damaging Het
Adam12 T C 7: 133,919,832 S566G probably benign Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Apob A T 12: 8,011,183 I3222F probably benign Het
Cdyl A G 13: 35,858,239 D420G probably benign Het
Cela1 C A 15: 100,683,013 A121S possibly damaging Het
Clip2 A G 5: 134,500,109 M822T probably benign Het
Coq8a G A 1: 180,179,211 T84I probably benign Het
Dars2 G A 1: 161,049,957 A390V probably benign Het
Dhx40 C T 11: 86,770,230 M744I probably benign Het
Dnajc14 A G 10: 128,806,820 I204V probably benign Het
Eftud2 A C 11: 102,860,029 F322V probably damaging Het
Faim2 T C 15: 99,521,216 T91A probably benign Het
Fam160a1 C A 3: 85,672,258 R880L probably benign Het
Fancl A T 11: 26,468,847 I290F possibly damaging Het
Fermt3 A T 19: 7,013,877 Y253N possibly damaging Het
Frem3 T A 8: 80,690,773 S2036T probably damaging Het
Gm10330 A T 12: 23,779,910 V90E probably damaging Het
Gm3147 T C 5: 94,614,984 T60A probably benign Het
Gm6509 A G 5: 94,624,058 T16A probably benign Het
Golga1 T C 2: 39,024,243 E488G probably benign Het
Gpatch11 T A 17: 78,841,017 L128Q possibly damaging Het
Hoxd9 A G 2: 74,699,195 N265S possibly damaging Het
Igfn1 C T 1: 135,959,782 V2515M probably damaging Het
Itga2b A G 11: 102,461,156 L505P probably damaging Het
Klrg2 A G 6: 38,636,556 S171P probably benign Het
Lamtor5 A G 3: 107,279,088 T58A probably benign Het
Lgr6 G T 1: 134,987,479 C787* probably null Het
Madd A G 2: 91,175,710 F380S probably damaging Het
Magi1 A T 6: 93,943,253 H127Q possibly damaging Het
Maml2 A G 9: 13,620,576 E362G Het
Mfsd7a G T 5: 108,441,998 P513T probably benign Het
Morc2b C T 17: 33,136,023 G925D probably benign Het
Nalcn C T 14: 123,281,111 R1672H probably damaging Het
Npsr1 A G 9: 24,313,197 Y290C possibly damaging Het
Obox5 A T 7: 15,757,952 E97D probably damaging Het
Parn C T 16: 13,664,655 probably null Het
Pip4k2b A T 11: 97,722,446 N241K probably damaging Het
Pkn2 A G 3: 142,810,748 V539A probably benign Het
Plpp7 A T 2: 32,095,812 M1L probably damaging Het
Prtg G A 9: 72,809,647 S90N probably benign Het
Rgs7bp G A 13: 104,964,110 T219M probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scgb1b20 G A 7: 33,373,573 D69N probably benign Het
Setd2 A G 9: 110,550,551 T1145A probably damaging Het
Tmem145 A G 7: 25,309,740 Q359R probably benign Het
Trmt5 C A 12: 73,282,674 D237Y probably damaging Het
Vmn1r169 A T 7: 23,577,965 I261F probably benign Het
Vmn1r19 A T 6: 57,405,337 I292F unknown Het
Vmn2r66 T C 7: 85,011,956 D22G probably benign Het
Vwa3b T A 1: 37,157,453 probably null Het
Wbp4 T A 14: 79,476,913 D53V probably benign Het
Xpo1 A G 11: 23,291,550 I866V probably benign Het
Zan G A 5: 137,463,992 P975L unknown Het
Zdhhc19 G A 16: 32,497,694 R89Q probably benign Het
Zer1 G A 2: 30,111,285 T69I probably benign Het
Zfp827 C T 8: 79,060,400 T65I probably damaging Het
Zswim9 A G 7: 13,261,057 F391S probably damaging Het
Other mutations in Eif4g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Eif4g2 APN 7 111074713 missense possibly damaging 0.91
IGL01402:Eif4g2 APN 7 111077027 missense possibly damaging 0.94
IGL02502:Eif4g2 APN 7 111081541 missense probably damaging 0.98
IGL02538:Eif4g2 APN 7 111079316 missense probably benign 0.03
IGL02717:Eif4g2 APN 7 111078113 missense probably benign 0.45
R0547:Eif4g2 UTSW 7 111078293 missense probably damaging 1.00
R0614:Eif4g2 UTSW 7 111077223 critical splice donor site probably null
R1351:Eif4g2 UTSW 7 111074080 missense probably damaging 1.00
R1764:Eif4g2 UTSW 7 111074487 missense probably damaging 1.00
R2009:Eif4g2 UTSW 7 111074198 missense probably benign 0.01
R2318:Eif4g2 UTSW 7 111073858 missense possibly damaging 0.78
R2382:Eif4g2 UTSW 7 111075046 missense probably benign 0.00
R2986:Eif4g2 UTSW 7 111078483 missense probably damaging 0.99
R4012:Eif4g2 UTSW 7 111074151 missense possibly damaging 0.86
R4592:Eif4g2 UTSW 7 111078302 missense probably damaging 1.00
R4785:Eif4g2 UTSW 7 111076796 missense probably damaging 0.99
R5037:Eif4g2 UTSW 7 111077032 missense probably benign 0.03
R5627:Eif4g2 UTSW 7 111074239 missense probably benign 0.32
R5988:Eif4g2 UTSW 7 111077230 missense probably benign 0.11
R6229:Eif4g2 UTSW 7 111077713 splice site probably null
R8122:Eif4g2 UTSW 7 111078553 missense possibly damaging 0.93
R8218:Eif4g2 UTSW 7 111074432 missense possibly damaging 0.62
R8711:Eif4g2 UTSW 7 111073920 missense probably damaging 1.00
R8726:Eif4g2 UTSW 7 111077422 missense probably damaging 1.00
R9156:Eif4g2 UTSW 7 111073762 missense
R9216:Eif4g2 UTSW 7 111074208 missense probably benign 0.08
R9334:Eif4g2 UTSW 7 111074824 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCATTTAGTGTTAAGTCAGCTGGC -3'
(R):5'- GCCACAAGTGACAACTTCATGC -3'

Sequencing Primer
(F):5'- AAGTCAGCTGGCTCTTACCTGG -3'
(R):5'- TGACAACTTCATGCAGGTAGAAC -3'
Posted On 2022-03-25