Incidental Mutation 'R9277:Xpo1'
ID 703383
Institutional Source Beutler Lab
Gene Symbol Xpo1
Ensembl Gene ENSMUSG00000020290
Gene Name exportin 1
Synonyms Crm1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9277 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 23256041-23298249 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23291550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 866 (I866V)
Ref Sequence ENSEMBL: ENSMUSP00000105178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]
AlphaFold Q6P5F9
PDB Structure Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020538
AA Change: I866V

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: I866V

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102869
AA Change: I866V

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: I866V

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 7.4e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102870
AA Change: I866V

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: I866V

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109551
AA Change: I866V

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: I866V

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150750
SMART Domains Protein: ENSMUSP00000117846
Gene: ENSMUSG00000020290

DomainStartEndE-ValueType
Blast:CRM1_C 97 136 3e-8 BLAST
Pfam:CRM1_C 171 233 4.3e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,976,521 Y237C probably damaging Het
Adam12 T C 7: 133,919,832 S566G probably benign Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Apob A T 12: 8,011,183 I3222F probably benign Het
Cdyl A G 13: 35,858,239 D420G probably benign Het
Cela1 C A 15: 100,683,013 A121S possibly damaging Het
Clip2 A G 5: 134,500,109 M822T probably benign Het
Coq8a G A 1: 180,179,211 T84I probably benign Het
Dars2 G A 1: 161,049,957 A390V probably benign Het
Dhx40 C T 11: 86,770,230 M744I probably benign Het
Dnajc14 A G 10: 128,806,820 I204V probably benign Het
Eftud2 A C 11: 102,860,029 F322V probably damaging Het
Eif4g2 G A 7: 111,074,859 A646V probably damaging Het
Faim2 T C 15: 99,521,216 T91A probably benign Het
Fam160a1 C A 3: 85,672,258 R880L probably benign Het
Fancl A T 11: 26,468,847 I290F possibly damaging Het
Fermt3 A T 19: 7,013,877 Y253N possibly damaging Het
Frem3 T A 8: 80,690,773 S2036T probably damaging Het
Gm10330 A T 12: 23,779,910 V90E probably damaging Het
Gm3147 T C 5: 94,614,984 T60A probably benign Het
Gm6509 A G 5: 94,624,058 T16A probably benign Het
Golga1 T C 2: 39,024,243 E488G probably benign Het
Gpatch11 T A 17: 78,841,017 L128Q possibly damaging Het
Hoxd9 A G 2: 74,699,195 N265S possibly damaging Het
Igfn1 C T 1: 135,959,782 V2515M probably damaging Het
Itga2b A G 11: 102,461,156 L505P probably damaging Het
Klrg2 A G 6: 38,636,556 S171P probably benign Het
Lamtor5 A G 3: 107,279,088 T58A probably benign Het
Lgr6 G T 1: 134,987,479 C787* probably null Het
Madd A G 2: 91,175,710 F380S probably damaging Het
Magi1 A T 6: 93,943,253 H127Q possibly damaging Het
Maml2 A G 9: 13,620,576 E362G Het
Mfsd7a G T 5: 108,441,998 P513T probably benign Het
Morc2b C T 17: 33,136,023 G925D probably benign Het
Nalcn C T 14: 123,281,111 R1672H probably damaging Het
Npsr1 A G 9: 24,313,197 Y290C possibly damaging Het
Obox5 A T 7: 15,757,952 E97D probably damaging Het
Parn C T 16: 13,664,655 probably null Het
Pip4k2b A T 11: 97,722,446 N241K probably damaging Het
Pkn2 A G 3: 142,810,748 V539A probably benign Het
Plpp7 A T 2: 32,095,812 M1L probably damaging Het
Prtg G A 9: 72,809,647 S90N probably benign Het
Rgs7bp G A 13: 104,964,110 T219M probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scgb1b20 G A 7: 33,373,573 D69N probably benign Het
Setd2 A G 9: 110,550,551 T1145A probably damaging Het
Tmem145 A G 7: 25,309,740 Q359R probably benign Het
Trmt5 C A 12: 73,282,674 D237Y probably damaging Het
Vmn1r169 A T 7: 23,577,965 I261F probably benign Het
Vmn1r19 A T 6: 57,405,337 I292F unknown Het
Vmn2r66 T C 7: 85,011,956 D22G probably benign Het
Vwa3b T A 1: 37,157,453 probably null Het
Wbp4 T A 14: 79,476,913 D53V probably benign Het
Zan G A 5: 137,463,992 P975L unknown Het
Zdhhc19 G A 16: 32,497,694 R89Q probably benign Het
Zer1 G A 2: 30,111,285 T69I probably benign Het
Zfp827 C T 8: 79,060,400 T65I probably damaging Het
Zswim9 A G 7: 13,261,057 F391S probably damaging Het
Other mutations in Xpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Xpo1 APN 11 23285094 missense probably damaging 1.00
IGL01464:Xpo1 APN 11 23267703 missense probably damaging 0.97
IGL01561:Xpo1 APN 11 23282706 missense possibly damaging 0.76
IGL01630:Xpo1 APN 11 23285846 missense probably benign 0.00
IGL01700:Xpo1 APN 11 23276422 splice site probably benign
IGL02000:Xpo1 APN 11 23296003 missense probably damaging 1.00
IGL02299:Xpo1 APN 11 23293915 splice site probably benign
IGL02313:Xpo1 APN 11 23277065 missense probably damaging 1.00
IGL02828:Xpo1 APN 11 23282593 missense probably damaging 0.97
IGL03210:Xpo1 APN 11 23278834 missense probably benign 0.01
IGL03329:Xpo1 APN 11 23284306 missense probably benign
PIT1430001:Xpo1 UTSW 11 23276437 missense possibly damaging 0.66
R0507:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R0594:Xpo1 UTSW 11 23280402 missense probably damaging 1.00
R0706:Xpo1 UTSW 11 23280441 missense probably benign 0.09
R0742:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R1385:Xpo1 UTSW 11 23261863 missense probably damaging 0.96
R1478:Xpo1 UTSW 11 23291623 missense probably damaging 0.99
R1483:Xpo1 UTSW 11 23284863 missense probably benign 0.04
R1694:Xpo1 UTSW 11 23281399 missense probably benign 0.12
R1775:Xpo1 UTSW 11 23271193 missense probably benign
R1827:Xpo1 UTSW 11 23285155 missense probably benign 0.00
R2262:Xpo1 UTSW 11 23284634 splice site probably null
R2263:Xpo1 UTSW 11 23284634 splice site probably null
R4510:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4511:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4840:Xpo1 UTSW 11 23278183 missense probably damaging 1.00
R4901:Xpo1 UTSW 11 23281327 missense possibly damaging 0.62
R5176:Xpo1 UTSW 11 23295977 missense probably damaging 0.99
R5508:Xpo1 UTSW 11 23294645 missense probably benign
R5927:Xpo1 UTSW 11 23268653 unclassified probably benign
R5927:Xpo1 UTSW 11 23268656 unclassified probably benign
R6110:Xpo1 UTSW 11 23287434 missense probably damaging 0.99
R6421:Xpo1 UTSW 11 23291490 missense possibly damaging 0.60
R6591:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6691:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6698:Xpo1 UTSW 11 23294040 missense probably benign 0.01
R6958:Xpo1 UTSW 11 23285855 missense probably benign
R7407:Xpo1 UTSW 11 23285823 missense probably damaging 1.00
R7482:Xpo1 UTSW 11 23282544 missense probably benign 0.00
R7624:Xpo1 UTSW 11 23282584 missense probably damaging 0.99
R8335:Xpo1 UTSW 11 23280603 splice site probably null
R8823:Xpo1 UTSW 11 23267752 missense probably benign
R9128:Xpo1 UTSW 11 23285058 missense probably damaging 1.00
R9232:Xpo1 UTSW 11 23282646 missense probably benign
Z1176:Xpo1 UTSW 11 23296080 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAAAATTTGGGCTTTCCTTTGG -3'
(R):5'- ACCAGATGCTAGAATGGCTCC -3'

Sequencing Primer
(F):5'- CCTTTGGGGGAAACTTTGAAG -3'
(R):5'- TCCCTGAAAACTAGATGCTCATG -3'
Posted On 2022-03-25