Incidental Mutation 'R9278:Spon1'
ID 703434
Institutional Source Beutler Lab
Gene Symbol Spon1
Ensembl Gene ENSMUSG00000038156
Gene Name spondin 1, (f-spondin) extracellular matrix protein
Synonyms FSP, D330035F22Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock # R9278 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 113765998-114043370 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114028953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 315 (S315P)
Ref Sequence ENSEMBL: ENSMUSP00000041157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046687]
AlphaFold Q8VCC9
Predicted Effect probably damaging
Transcript: ENSMUST00000046687
AA Change: S315P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156
AA Change: S315P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 93.4%
  • 10x: 93.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,804,008 C59S probably damaging Het
Aicda C T 6: 122,561,895 A161V possibly damaging Het
Ankrd12 C T 17: 66,037,604 E91K possibly damaging Het
Arpc2 C A 1: 74,236,882 F19L probably benign Het
Aspa T C 11: 73,324,454 K12E possibly damaging Het
Chd8 G A 14: 52,235,170 P392L probably benign Het
Cldn10 C T 14: 118,874,235 R206W probably damaging Het
Clec4b2 T A 6: 123,204,265 M203K probably damaging Het
Clec4d T C 6: 123,274,690 M177T probably benign Het
Clec4d G T 6: 123,274,692 E178* probably null Het
Cmpk2 A T 12: 26,469,569 Y73F probably benign Het
Col1a1 T A 11: 94,947,277 V845D unknown Het
Cyp2c67 C T 19: 39,609,255 R433Q probably damaging Het
Dda1 A T 8: 71,474,486 probably null Het
Ddx60 A T 8: 61,977,978 Y849F possibly damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dtwd1 C T 2: 126,164,808 T250I probably damaging Het
Efcab6 A G 15: 83,892,893 V1114A probably damaging Het
Fat4 A G 3: 38,891,022 T1355A probably benign Het
Fbxo40 T G 16: 36,969,578 D390A possibly damaging Het
Gm7534 A G 4: 134,195,459 L521P probably damaging Het
Gnaz T A 10: 74,991,605 L63Q probably benign Het
H6pd T A 4: 149,995,850 K179N probably damaging Het
Hps5 A G 7: 46,790,973 F18L probably benign Het
Hyal5 A G 6: 24,876,695 E189G probably benign Het
Ifnar1 T A 16: 91,505,125 I496N probably damaging Het
Igf2r C A 17: 12,695,353 C1743F probably damaging Het
Igfn1 C A 1: 135,973,447 R431L probably damaging Het
Itch A G 2: 155,203,297 Q507R probably benign Het
Kbtbd2 C A 6: 56,780,346 R135L probably damaging Het
Kcnn2 T C 18: 45,592,379 I314T probably damaging Het
Lix1 A G 17: 17,402,949 D2G probably damaging Het
Lrp1b T C 2: 40,597,064 Y4557C Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Med19 G T 2: 84,678,631 G63C probably damaging Het
Mfsd4b1 C T 10: 40,007,334 R40H probably damaging Het
Neb C T 2: 52,256,178 R2929H probably damaging Het
Nlrc5 A G 8: 94,511,280 D1434G probably benign Het
Nlrp14 A T 7: 107,197,842 N972I probably damaging Het
Olfr1247 A C 2: 89,609,604 F166C probably damaging Het
Olfr128 A T 17: 37,924,384 M273L probably benign Het
Olfr132 A T 17: 38,130,802 L130Q probably damaging Het
Olfr46 T C 7: 140,611,023 Y278H probably damaging Het
Olfr947-ps1 A G 9: 39,289,485 V135A probably benign Het
Otop1 T C 5: 38,302,815 V575A probably damaging Het
Pcdhb4 A G 18: 37,308,872 S412G possibly damaging Het
Pcsk4 T C 10: 80,325,390 D230G probably damaging Het
Phldb2 C A 16: 45,825,945 S46I probably damaging Het
Pik3ca A T 3: 32,454,438 N785I probably damaging Het
Polr2b A G 5: 77,323,638 R274G probably damaging Het
Prkdc G A 16: 15,816,659 probably null Het
Prune2 C T 19: 17,123,780 T2216I probably benign Het
Psma3 A T 12: 70,994,382 D252V probably benign Het
Rnf213 T C 11: 119,435,942 V1586A Het
Ryr2 T C 13: 11,883,090 T140A probably benign Het
Slc25a48 A G 13: 56,463,739 I220V probably benign Het
Slc2a1 A T 4: 119,133,410 E246D probably benign Het
Slc45a4 A G 15: 73,586,357 Y448H probably benign Het
Sorl1 C T 9: 42,046,561 V596I probably benign Het
Spag6 A C 2: 18,699,174 E11A probably benign Het
Spef2 A G 15: 9,727,409 probably null Het
Stard3 G A 11: 98,372,105 probably benign Het
Sv2c A G 13: 95,976,081 M636T probably damaging Het
Syt17 T A 7: 118,434,257 D172V probably damaging Het
Tcf4 A G 18: 69,633,581 Y206C probably damaging Het
Tead2 G T 7: 45,231,352 S318I probably benign Het
Tom1 A T 8: 75,057,255 D289V probably damaging Het
Tsen15 T C 1: 152,383,347 I87V probably damaging Het
Ttc30a2 T C 2: 75,977,031 D379G probably damaging Het
Usp15 A G 10: 123,171,207 F123S probably damaging Het
Vmn1r220 A T 13: 23,184,088 I146N possibly damaging Het
Vmn2r108 A T 17: 20,472,299 N98K probably benign Het
Vmn2r71 T A 7: 85,620,580 M433K probably benign Het
Vmn2r97 A T 17: 18,914,500 H60L probably benign Het
Wbp4 A G 14: 79,462,046 V336A probably benign Het
Zfp663 T C 2: 165,360,090 probably null Het
Other mutations in Spon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Spon1 APN 7 114034290 missense probably damaging 1.00
IGL02385:Spon1 APN 7 113766330 start codon destroyed probably null 0.56
IGL02496:Spon1 APN 7 114036662 missense probably benign 0.00
IGL02562:Spon1 APN 7 114036761 missense probably benign 0.12
IGL03063:Spon1 APN 7 114033025 missense possibly damaging 0.85
IGL03153:Spon1 APN 7 114030344 missense probably damaging 1.00
IGL03392:Spon1 APN 7 114034287 missense probably damaging 0.99
Rust UTSW 7 114016791 missense possibly damaging 0.77
Wilt UTSW 7 113766384 missense probably damaging 0.98
R0512:Spon1 UTSW 7 113836833 missense possibly damaging 0.59
R0646:Spon1 UTSW 7 114039821 missense probably benign 0.04
R1194:Spon1 UTSW 7 113886798 missense probably benign
R1832:Spon1 UTSW 7 114016785 missense probably benign 0.26
R2391:Spon1 UTSW 7 113886847 missense probably damaging 1.00
R3747:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3747:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3749:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3750:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3750:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R4666:Spon1 UTSW 7 114028969 missense probably benign 0.20
R4730:Spon1 UTSW 7 114033071 missense possibly damaging 0.92
R4774:Spon1 UTSW 7 114039867 missense probably damaging 0.99
R5855:Spon1 UTSW 7 114029072 missense probably damaging 0.99
R5870:Spon1 UTSW 7 114031786 missense probably damaging 1.00
R5914:Spon1 UTSW 7 114030821 missense probably damaging 1.00
R6523:Spon1 UTSW 7 113886785 missense probably benign 0.00
R7138:Spon1 UTSW 7 114036710 missense probably damaging 1.00
R7295:Spon1 UTSW 7 114030240 missense possibly damaging 0.85
R7844:Spon1 UTSW 7 114030332 missense probably benign 0.01
R8064:Spon1 UTSW 7 114036621 missense probably damaging 1.00
R8075:Spon1 UTSW 7 114016793 critical splice donor site probably null
R8927:Spon1 UTSW 7 114030357 critical splice donor site probably null
R8928:Spon1 UTSW 7 114030357 critical splice donor site probably null
Z1088:Spon1 UTSW 7 113766386 missense possibly damaging 0.83
Z1176:Spon1 UTSW 7 113927794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCTTGAGGAACCAATCTGC -3'
(R):5'- GGACACCTAGAACATGGCAGAC -3'

Sequencing Primer
(F):5'- GCTTGAGGAACCAATCTGCATTCAC -3'
(R):5'- CTGAGGGAGTTTGCCTTCC -3'
Posted On 2022-03-25