Incidental Mutation 'R9278:Olfr46'
ID 703436
Institutional Source Beutler Lab
Gene Symbol Olfr46
Ensembl Gene ENSMUSG00000093942
Gene Name olfactory receptor 46
Synonyms ID12, IF5, MOR253-8, GA_x6K02T2PBJ9-42759973-42760905, IB7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R9278 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140601269-140617678 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140611023 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 278 (Y278H)
Ref Sequence ENSEMBL: ENSMUSP00000147582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072655] [ENSMUST00000211771] [ENSMUST00000214180]
AlphaFold Q8VGJ4
Predicted Effect probably damaging
Transcript: ENSMUST00000072655
AA Change: Y286H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072445
Gene: ENSMUSG00000093942
AA Change: Y286H

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 43 209 5.9e-8 PFAM
Pfam:7tm_1 49 298 3.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211771
AA Change: Y278H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214180
AA Change: Y278H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 93.4%
  • 10x: 93.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,804,008 C59S probably damaging Het
Aicda C T 6: 122,561,895 A161V possibly damaging Het
Ankrd12 C T 17: 66,037,604 E91K possibly damaging Het
Arpc2 C A 1: 74,236,882 F19L probably benign Het
Aspa T C 11: 73,324,454 K12E possibly damaging Het
Chd8 G A 14: 52,235,170 P392L probably benign Het
Cldn10 C T 14: 118,874,235 R206W probably damaging Het
Clec4b2 T A 6: 123,204,265 M203K probably damaging Het
Clec4d T C 6: 123,274,690 M177T probably benign Het
Clec4d G T 6: 123,274,692 E178* probably null Het
Cmpk2 A T 12: 26,469,569 Y73F probably benign Het
Col1a1 T A 11: 94,947,277 V845D unknown Het
Cyp2c67 C T 19: 39,609,255 R433Q probably damaging Het
Dda1 A T 8: 71,474,486 probably null Het
Ddx60 A T 8: 61,977,978 Y849F possibly damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dtwd1 C T 2: 126,164,808 T250I probably damaging Het
Efcab6 A G 15: 83,892,893 V1114A probably damaging Het
Fat4 A G 3: 38,891,022 T1355A probably benign Het
Fbxo40 T G 16: 36,969,578 D390A possibly damaging Het
Gm7534 A G 4: 134,195,459 L521P probably damaging Het
Gnaz T A 10: 74,991,605 L63Q probably benign Het
H6pd T A 4: 149,995,850 K179N probably damaging Het
Hps5 A G 7: 46,790,973 F18L probably benign Het
Hyal5 A G 6: 24,876,695 E189G probably benign Het
Ifnar1 T A 16: 91,505,125 I496N probably damaging Het
Igf2r C A 17: 12,695,353 C1743F probably damaging Het
Igfn1 C A 1: 135,973,447 R431L probably damaging Het
Itch A G 2: 155,203,297 Q507R probably benign Het
Kbtbd2 C A 6: 56,780,346 R135L probably damaging Het
Kcnn2 T C 18: 45,592,379 I314T probably damaging Het
Lix1 A G 17: 17,402,949 D2G probably damaging Het
Lrp1b T C 2: 40,597,064 Y4557C Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Med19 G T 2: 84,678,631 G63C probably damaging Het
Mfsd4b1 C T 10: 40,007,334 R40H probably damaging Het
Neb C T 2: 52,256,178 R2929H probably damaging Het
Nlrc5 A G 8: 94,511,280 D1434G probably benign Het
Nlrp14 A T 7: 107,197,842 N972I probably damaging Het
Olfr1247 A C 2: 89,609,604 F166C probably damaging Het
Olfr128 A T 17: 37,924,384 M273L probably benign Het
Olfr132 A T 17: 38,130,802 L130Q probably damaging Het
Olfr947-ps1 A G 9: 39,289,485 V135A probably benign Het
Otop1 T C 5: 38,302,815 V575A probably damaging Het
Pcdhb4 A G 18: 37,308,872 S412G possibly damaging Het
Pcsk4 T C 10: 80,325,390 D230G probably damaging Het
Phldb2 C A 16: 45,825,945 S46I probably damaging Het
Pik3ca A T 3: 32,454,438 N785I probably damaging Het
Polr2b A G 5: 77,323,638 R274G probably damaging Het
Prkdc G A 16: 15,816,659 probably null Het
Prune2 C T 19: 17,123,780 T2216I probably benign Het
Psma3 A T 12: 70,994,382 D252V probably benign Het
Rnf213 T C 11: 119,435,942 V1586A Het
Ryr2 T C 13: 11,883,090 T140A probably benign Het
Slc25a48 A G 13: 56,463,739 I220V probably benign Het
Slc2a1 A T 4: 119,133,410 E246D probably benign Het
Slc45a4 A G 15: 73,586,357 Y448H probably benign Het
Sorl1 C T 9: 42,046,561 V596I probably benign Het
Spag6 A C 2: 18,699,174 E11A probably benign Het
Spef2 A G 15: 9,727,409 probably null Het
Spon1 T C 7: 114,028,953 S315P probably damaging Het
Stard3 G A 11: 98,372,105 probably benign Het
Sv2c A G 13: 95,976,081 M636T probably damaging Het
Syt17 T A 7: 118,434,257 D172V probably damaging Het
Tcf4 A G 18: 69,633,581 Y206C probably damaging Het
Tead2 G T 7: 45,231,352 S318I probably benign Het
Tom1 A T 8: 75,057,255 D289V probably damaging Het
Tsen15 T C 1: 152,383,347 I87V probably damaging Het
Ttc30a2 T C 2: 75,977,031 D379G probably damaging Het
Usp15 A G 10: 123,171,207 F123S probably damaging Het
Vmn1r220 A T 13: 23,184,088 I146N possibly damaging Het
Vmn2r108 A T 17: 20,472,299 N98K probably benign Het
Vmn2r71 T A 7: 85,620,580 M433K probably benign Het
Vmn2r97 A T 17: 18,914,500 H60L probably benign Het
Wbp4 A G 14: 79,462,046 V336A probably benign Het
Zfp663 T C 2: 165,360,090 probably null Het
Other mutations in Olfr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr46 APN 7 140610753 missense probably damaging 1.00
IGL02408:Olfr46 APN 7 140610931 missense probably damaging 1.00
IGL02496:Olfr46 APN 7 140610168 start codon destroyed probably benign
IGL03003:Olfr46 APN 7 140610370 missense probably damaging 1.00
R0538:Olfr46 UTSW 7 140610384 missense probably damaging 1.00
R1350:Olfr46 UTSW 7 140610709 missense probably damaging 0.96
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R2008:Olfr46 UTSW 7 140610585 missense probably damaging 1.00
R4110:Olfr46 UTSW 7 140610264 missense probably benign 0.20
R4110:Olfr46 UTSW 7 140610265 missense possibly damaging 0.89
R4255:Olfr46 UTSW 7 140610587 nonsense probably null
R4622:Olfr46 UTSW 7 140610698 nonsense probably null
R4809:Olfr46 UTSW 7 140611074 missense probably damaging 0.98
R4826:Olfr46 UTSW 7 140610319 missense probably benign 0.02
R4989:Olfr46 UTSW 7 140610391 missense possibly damaging 0.95
R5177:Olfr46 UTSW 7 140610189 missense probably benign 0.00
R5261:Olfr46 UTSW 7 140610663 missense probably benign 0.00
R5770:Olfr46 UTSW 7 140610943 missense probably damaging 1.00
R5863:Olfr46 UTSW 7 140610631 missense probably damaging 0.97
R6082:Olfr46 UTSW 7 140610681 missense probably benign 0.00
R6705:Olfr46 UTSW 7 140610784 missense probably damaging 0.99
R7216:Olfr46 UTSW 7 140610460 missense possibly damaging 0.87
R7443:Olfr46 UTSW 7 140611048 missense probably damaging 1.00
R7485:Olfr46 UTSW 7 140610178 missense probably benign 0.02
R7806:Olfr46 UTSW 7 140610772 missense probably benign 0.00
R8373:Olfr46 UTSW 7 140610295 missense possibly damaging 0.88
R8884:Olfr46 UTSW 7 140610703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCATTGCCAGCATCCTG -3'
(R):5'- TCCAGTCTTCTCATCAGACAGAGG -3'

Sequencing Primer
(F):5'- GCGCATGCGTTCTGCTGAG -3'
(R):5'- CTCATCAGACAGAGGTTTTCTAAAGC -3'
Posted On 2022-03-25