Incidental Mutation 'R0751:Olfr385'
ID70344
Institutional Source Beutler Lab
Gene Symbol Olfr385
Ensembl Gene ENSMUSG00000095095
Gene Nameolfactory receptor 385
SynonymsMOR135-3, GA_x6K02T2P1NL-3760313-3759375
MMRRC Submission 038931-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0751 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73588302-73593008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73589144 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 198 (T198K)
Ref Sequence ENSEMBL: ENSMUSP00000149293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071553] [ENSMUST00000215689]
Predicted Effect probably benign
Transcript: ENSMUST00000071553
AA Change: T198K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071484
Gene: ENSMUSG00000095095
AA Change: T198K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.1e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.7e-6 PFAM
Pfam:7tm_1 41 290 2.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215689
AA Change: T198K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alox12 T C 11: 70,246,950 I455V probably benign Het
Ankrd28 A G 14: 31,764,268 L89P probably damaging Het
Aqp9 A T 9: 71,138,205 C41S probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Aspm A T 1: 139,456,898 probably benign Het
Cacfd1 T C 2: 27,018,981 probably null Het
Cd33 T C 7: 43,532,121 D205G probably damaging Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chtf8 A G 8: 106,886,477 probably null Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Clock A T 5: 76,229,361 I696K possibly damaging Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Derl2 T C 11: 71,014,547 probably null Het
Dnah7c A G 1: 46,465,905 T154A probably benign Het
Dnmt3b T A 2: 153,674,842 probably null Het
Dusp3 A T 11: 101,981,728 S106T probably benign Het
Eftud2 A G 11: 102,839,253 V897A probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Fbxo33 A C 12: 59,219,092 F130V probably damaging Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fig4 T C 10: 41,272,982 D158G probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gabra2 A G 5: 71,092,099 probably benign Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Gm9268 A G 7: 43,047,409 Y630C probably damaging Het
Hkdc1 T C 10: 62,398,673 D581G probably damaging Het
Iqgap1 A G 7: 80,725,573 probably benign Het
Larp4b T C 13: 9,166,309 probably benign Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Lrrc8a T C 2: 30,256,350 V392A possibly damaging Het
Mavs A T 2: 131,246,764 Y496F probably damaging Het
Mpi A T 9: 57,550,614 S102T probably damaging Het
Mroh9 G A 1: 163,066,124 R161W possibly damaging Het
Myo1h A T 5: 114,320,686 S161C probably damaging Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Nelfcd C A 2: 174,423,014 A182D probably benign Het
Ntsr2 G T 12: 16,654,030 K91N probably damaging Het
Obscn A G 11: 59,081,819 S2134P probably damaging Het
Ogfod2 G A 5: 124,113,476 probably benign Het
Olfr525 G A 7: 140,323,325 V209I probably benign Het
Pcdha8 T C 18: 36,994,070 V535A probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pimreg C A 11: 72,043,113 Q22K probably benign Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ppip5k2 A T 1: 97,749,652 C306* probably null Het
Ptprc A G 1: 138,092,930 Y588H probably damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc12a4 A T 8: 105,951,900 V266E probably damaging Het
Slc8b1 A G 5: 120,524,195 probably benign Het
Smim4 G T 14: 31,088,996 probably benign Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Ssb T A 2: 69,870,565 S330T probably benign Het
Stard9 G T 2: 120,697,485 V1408F probably benign Het
Sumf2 A T 5: 129,850,005 T61S probably benign Het
Sypl2 T C 3: 108,216,756 T157A probably damaging Het
Tgfbr3 A T 5: 107,139,883 D483E probably damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Tradd T C 8: 105,259,771 E123G probably damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Ttc30a2 C T 2: 75,978,031 A46T probably damaging Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ubr4 C T 4: 139,437,198 probably benign Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vmn2r63 A C 7: 42,928,035 F360V probably damaging Het
Vmn2r78 G A 7: 86,954,380 V589M possibly damaging Het
Vrk2 A G 11: 26,483,331 probably benign Het
Other mutations in Olfr385
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Olfr385 APN 11 73589383 missense probably benign 0.34
IGL02045:Olfr385 APN 11 73589232 missense probably damaging 1.00
IGL02324:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02328:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02562:Olfr385 APN 11 73589411 missense probably benign
IGL02715:Olfr385 APN 11 73589121 missense probably benign 0.00
IGL03182:Olfr385 APN 11 73589442 missense probably benign 0.04
IGL03048:Olfr385 UTSW 11 73589005 missense possibly damaging 0.56
R0346:Olfr385 UTSW 11 73589457 missense probably damaging 1.00
R0675:Olfr385 UTSW 11 73589252 missense probably damaging 1.00
R1220:Olfr385 UTSW 11 73589377 nonsense probably null
R1389:Olfr385 UTSW 11 73589543 missense possibly damaging 0.88
R1484:Olfr385 UTSW 11 73589361 missense possibly damaging 0.91
R1619:Olfr385 UTSW 11 73589292 missense probably damaging 1.00
R2290:Olfr385 UTSW 11 73588919 missense probably benign 0.37
R3713:Olfr385 UTSW 11 73588905 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589368 nonsense probably null
R3782:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3782:Olfr385 UTSW 11 73589368 nonsense probably null
R4402:Olfr385 UTSW 11 73589255 missense probably benign 0.02
R4721:Olfr385 UTSW 11 73589447 missense probably damaging 1.00
R5157:Olfr385 UTSW 11 73589723 missense probably damaging 1.00
R5995:Olfr385 UTSW 11 73589250 missense probably benign
R6373:Olfr385 UTSW 11 73588898 missense probably benign 0.42
R6658:Olfr385 UTSW 11 73589048 missense probably damaging 0.99
R7046:Olfr385 UTSW 11 73589732 missense probably benign
R7096:Olfr385 UTSW 11 73589637 missense probably benign 0.03
R7238:Olfr385 UTSW 11 73589735 start codon destroyed probably null 0.99
R7537:Olfr385 UTSW 11 73589268 missense probably benign 0.04
R7548:Olfr385 UTSW 11 73588976 missense possibly damaging 0.56
R7888:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
R7971:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGGCAGTGTCCTTCACAGTAGAG -3'
(R):5'- TCTTATGTTCATGGCCTATGACCGC -3'

Sequencing Primer
(F):5'- AGTGTCCTTCACAGTAGAGTTATTAG -3'
(R):5'- CGTTATACCAGCATCATGAGTC -3'
Posted On2013-09-30