Incidental Mutation 'R0751:Eftud2'
ID 70346
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Name elongation factor Tu GTP binding domain containing 2
Synonyms 116kDa, Snrp116, U5-116kD
MMRRC Submission 038931-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0751 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 102729299-102771811 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102730079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 897 (V897A)
Ref Sequence ENSEMBL: ENSMUSP00000134327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021302] [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000107072] [ENSMUST00000107073] [ENSMUST00000173679]
AlphaFold O08810
Predicted Effect probably benign
Transcript: ENSMUST00000021302
SMART Domains Protein: ENSMUSP00000021302
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021306
AA Change: V907A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: V907A

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107060
AA Change: V906A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: V906A

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107072
SMART Domains Protein: ENSMUSP00000102687
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107073
SMART Domains Protein: ENSMUSP00000102688
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132543
SMART Domains Protein: ENSMUSP00000133732
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFG_IV 1 65 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143323
Predicted Effect probably benign
Transcript: ENSMUST00000172611
SMART Domains Protein: ENSMUSP00000134316
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 85 98 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173679
AA Change: V897A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: V897A

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Meta Mutation Damage Score 0.8083 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T A 4: 132,792,707 (GRCm39) M1316K probably benign Het
Alox12 T C 11: 70,137,776 (GRCm39) I455V probably benign Het
Ankrd28 A G 14: 31,486,225 (GRCm39) L89P probably damaging Het
Aqp9 A T 9: 71,045,487 (GRCm39) C41S probably damaging Het
Arhgap17 T C 7: 122,913,913 (GRCm39) Y199C probably damaging Het
Aspm A T 1: 139,384,636 (GRCm39) probably benign Het
Cacfd1 T C 2: 26,908,993 (GRCm39) probably null Het
Cd33 T C 7: 43,181,545 (GRCm39) D205G probably damaging Het
Chadl T C 15: 81,577,258 (GRCm39) S198G probably benign Het
Chtf8 A G 8: 107,613,109 (GRCm39) probably null Het
Clec4a4 G T 6: 122,989,671 (GRCm39) W104L probably benign Het
Clock A T 5: 76,377,208 (GRCm39) I696K possibly damaging Het
Crtc2 T A 3: 90,169,940 (GRCm39) Y445* probably null Het
Dapk1 A T 13: 60,844,112 (GRCm39) I44F probably damaging Het
Dcbld2 T A 16: 58,270,204 (GRCm39) probably null Het
Derl2 T C 11: 70,905,373 (GRCm39) probably null Het
Dnah7c A G 1: 46,505,065 (GRCm39) T154A probably benign Het
Dnmt3b T A 2: 153,516,762 (GRCm39) probably null Het
Dusp3 A T 11: 101,872,554 (GRCm39) S106T probably benign Het
Eif3l T A 15: 78,959,966 (GRCm39) probably null Het
Fbxo33 A C 12: 59,265,878 (GRCm39) F130V probably damaging Het
Ffar3 T A 7: 30,554,529 (GRCm39) N264Y probably damaging Het
Fig4 T C 10: 41,148,978 (GRCm39) D158G probably damaging Het
Fyco1 A G 9: 123,648,218 (GRCm39) F1239L probably damaging Het
Gabra2 A G 5: 71,249,442 (GRCm39) probably benign Het
Gabra6 C A 11: 42,205,844 (GRCm39) R336S probably benign Het
Hkdc1 T C 10: 62,234,452 (GRCm39) D581G probably damaging Het
Ift70a2 C T 2: 75,808,375 (GRCm39) A46T probably damaging Het
Iqgap1 A G 7: 80,375,321 (GRCm39) probably benign Het
Larp4b T C 13: 9,216,345 (GRCm39) probably benign Het
Lcp1 A T 14: 75,436,827 (GRCm39) M58L probably benign Het
Lrrc8a T C 2: 30,146,362 (GRCm39) V392A possibly damaging Het
Mavs A T 2: 131,088,684 (GRCm39) Y496F probably damaging Het
Mpi A T 9: 57,457,897 (GRCm39) S102T probably damaging Het
Mroh9 G A 1: 162,893,693 (GRCm39) R161W possibly damaging Het
Myo1h A T 5: 114,458,747 (GRCm39) S161C probably damaging Het
Napg T G 18: 63,127,409 (GRCm39) H204Q probably benign Het
Nelfcd C A 2: 174,264,807 (GRCm39) A182D probably benign Het
Ntsr2 G T 12: 16,704,031 (GRCm39) K91N probably damaging Het
Obscn A G 11: 58,972,645 (GRCm39) S2134P probably damaging Het
Ogfod2 G A 5: 124,251,539 (GRCm39) probably benign Het
Or13a19 G A 7: 139,903,238 (GRCm39) V209I probably benign Het
Or1e26 G T 11: 73,479,970 (GRCm39) T198K probably benign Het
Pcdha8 T C 18: 37,127,123 (GRCm39) V535A probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pik3r1 T C 13: 101,822,866 (GRCm39) probably null Het
Pimreg C A 11: 71,933,939 (GRCm39) Q22K probably benign Het
Pld5 A G 1: 175,872,462 (GRCm39) I225T probably damaging Het
Plxnc1 T C 10: 94,667,195 (GRCm39) probably benign Het
Ppip5k2 A T 1: 97,677,377 (GRCm39) C306* probably null Het
Ptprc A G 1: 138,020,668 (GRCm39) Y588H probably damaging Het
Rac2 T G 15: 78,450,145 (GRCm39) D65A possibly damaging Het
Rgl3 A G 9: 21,888,676 (GRCm39) probably null Het
Serpinb1a T C 13: 33,027,199 (GRCm39) K248E probably benign Het
Serpinb9e A C 13: 33,443,757 (GRCm39) E259A probably benign Het
Slc12a4 A T 8: 106,678,532 (GRCm39) V266E probably damaging Het
Slc8b1 A G 5: 120,662,260 (GRCm39) probably benign Het
Spink6 T C 18: 44,204,605 (GRCm39) probably benign Het
Spta1 G A 1: 174,012,256 (GRCm39) R354H probably damaging Het
Ssb T A 2: 69,700,909 (GRCm39) S330T probably benign Het
Stard9 G T 2: 120,527,966 (GRCm39) V1408F probably benign Het
Sumf2 A T 5: 129,878,846 (GRCm39) T61S probably benign Het
Sypl2 T C 3: 108,124,072 (GRCm39) T157A probably damaging Het
Tgfbr3 A T 5: 107,287,749 (GRCm39) D483E probably damaging Het
Tnrc6a A G 7: 122,769,563 (GRCm39) N451S possibly damaging Het
Tradd T C 8: 105,986,403 (GRCm39) E123G probably damaging Het
Trim36 T C 18: 46,329,318 (GRCm39) T41A probably damaging Het
Ttll7 C T 3: 146,645,746 (GRCm39) P535S probably damaging Het
Ubr4 C T 4: 139,164,509 (GRCm39) probably benign Het
Uqcc5 G T 14: 30,810,953 (GRCm39) probably benign Het
Vmn1r195 A G 13: 22,463,181 (GRCm39) Y217C probably damaging Het
Vmn2r63 A C 7: 42,577,459 (GRCm39) F360V probably damaging Het
Vmn2r78 G A 7: 86,603,588 (GRCm39) V589M possibly damaging Het
Vmn2r-ps158 A G 7: 42,696,833 (GRCm39) Y630C probably damaging Het
Vrk2 A G 11: 26,433,331 (GRCm39) probably benign Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102,756,389 (GRCm39) splice site probably benign
IGL01765:Eftud2 APN 11 102,730,082 (GRCm39) missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102,759,953 (GRCm39) missense probably benign 0.08
IGL02161:Eftud2 APN 11 102,745,702 (GRCm39) splice site probably benign
IGL02165:Eftud2 APN 11 102,742,573 (GRCm39) splice site probably benign
IGL02218:Eftud2 APN 11 102,761,039 (GRCm39) missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102,742,580 (GRCm39) splice site probably null
IGL02664:Eftud2 APN 11 102,732,538 (GRCm39) missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102,737,440 (GRCm39) missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102,761,082 (GRCm39) splice site probably benign
IGL02870:Eftud2 APN 11 102,753,452 (GRCm39) missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102,761,009 (GRCm39) missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102,759,443 (GRCm39) missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102,755,551 (GRCm39) missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102,755,627 (GRCm39) splice site probably benign
R0463:Eftud2 UTSW 11 102,755,597 (GRCm39) missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102,735,048 (GRCm39) missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102,730,079 (GRCm39) missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102,737,446 (GRCm39) missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102,740,010 (GRCm39) missense probably benign
R1079:Eftud2 UTSW 11 102,730,870 (GRCm39) nonsense probably null
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1220:Eftud2 UTSW 11 102,742,573 (GRCm39) splice site probably benign
R1438:Eftud2 UTSW 11 102,750,868 (GRCm39) missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102,730,266 (GRCm39) missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102,745,597 (GRCm39) splice site probably benign
R2270:Eftud2 UTSW 11 102,755,607 (GRCm39) missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102,735,006 (GRCm39) missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102,732,289 (GRCm39) splice site probably null
R3892:Eftud2 UTSW 11 102,737,013 (GRCm39) missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102,750,936 (GRCm39) missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102,730,242 (GRCm39) splice site probably null
R4794:Eftud2 UTSW 11 102,761,003 (GRCm39) missense probably benign 0.14
R4841:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102,758,670 (GRCm39) critical splice donor site probably null
R5208:Eftud2 UTSW 11 102,732,011 (GRCm39) missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102,730,883 (GRCm39) missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102,755,606 (GRCm39) missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102,729,449 (GRCm39) nonsense probably null
R7604:Eftud2 UTSW 11 102,738,838 (GRCm39) missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102,730,934 (GRCm39) missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8019:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8139:Eftud2 UTSW 11 102,758,685 (GRCm39) missense probably benign 0.04
R8431:Eftud2 UTSW 11 102,737,062 (GRCm39) missense probably benign 0.08
R8545:Eftud2 UTSW 11 102,731,097 (GRCm39) missense probably damaging 1.00
R8676:Eftud2 UTSW 11 102,759,447 (GRCm39) missense probably damaging 1.00
R9089:Eftud2 UTSW 11 102,759,971 (GRCm39) missense probably benign
R9173:Eftud2 UTSW 11 102,734,242 (GRCm39) missense probably damaging 1.00
R9277:Eftud2 UTSW 11 102,750,855 (GRCm39) missense probably damaging 1.00
R9313:Eftud2 UTSW 11 102,730,262 (GRCm39) missense probably benign 0.03
R9604:Eftud2 UTSW 11 102,737,056 (GRCm39) missense probably benign 0.11
R9664:Eftud2 UTSW 11 102,759,422 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTGCAGAGACTGATCTTTCCTCC -3'
(R):5'- CCATCGACTCATTCGGCTTTGAGAC -3'

Sequencing Primer
(F):5'- GAGACTGATCTTTCCTCCAAGAG -3'
(R):5'- TTCCACCATTGGCAGGTGAG -3'
Posted On 2013-09-30