Incidental Mutation 'R9278:Pcdhb4'
ID 703477
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Name protocadherin beta 4
Synonyms PcdhbD, Pcdhb5A
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9278 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37440508-37444225 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37441925 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 412 (S412G)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91XZ6
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056712
AA Change: S412G

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: S412G

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 93.4%
  • 10x: 93.2%
  • 20x: 92.9%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 14,024,270 (GRCm39) C59S probably damaging Het
Aicda C T 6: 122,538,854 (GRCm39) A161V possibly damaging Het
Ankrd12 C T 17: 66,344,599 (GRCm39) E91K possibly damaging Het
Arpc2 C A 1: 74,276,041 (GRCm39) F19L probably benign Het
Aspa T C 11: 73,215,280 (GRCm39) K12E possibly damaging Het
Chd8 G A 14: 52,472,627 (GRCm39) P392L probably benign Het
Cldn10 C T 14: 119,111,647 (GRCm39) R206W probably damaging Het
Clec4b2 T A 6: 123,181,224 (GRCm39) M203K probably damaging Het
Clec4d G T 6: 123,251,651 (GRCm39) E178* probably null Het
Clec4d T C 6: 123,251,649 (GRCm39) M177T probably benign Het
Cmpk2 A T 12: 26,519,568 (GRCm39) Y73F probably benign Het
Col1a1 T A 11: 94,838,103 (GRCm39) V845D unknown Het
Cyp2c67 C T 19: 39,597,699 (GRCm39) R433Q probably damaging Het
Dda1 A T 8: 71,927,130 (GRCm39) probably null Het
Ddx60 A T 8: 62,431,012 (GRCm39) Y849F possibly damaging Het
Dnm2 C T 9: 21,416,977 (GRCm39) R837W possibly damaging Het
Dtwd1 C T 2: 126,006,728 (GRCm39) T250I probably damaging Het
Efcab6 A G 15: 83,777,094 (GRCm39) V1114A probably damaging Het
Fat4 A G 3: 38,945,171 (GRCm39) T1355A probably benign Het
Fbxo40 T G 16: 36,789,940 (GRCm39) D390A possibly damaging Het
Gnaz T A 10: 74,827,437 (GRCm39) L63Q probably benign Het
H6pd T A 4: 150,080,307 (GRCm39) K179N probably damaging Het
Hmgb2 A G 8: 57,965,786 (GRCm39) probably benign Het
Hps5 A G 7: 46,440,397 (GRCm39) F18L probably benign Het
Hyal5 A G 6: 24,876,694 (GRCm39) E189G probably benign Het
Ifnar1 T A 16: 91,302,013 (GRCm39) I496N probably damaging Het
Ift70a2 T C 2: 75,807,375 (GRCm39) D379G probably damaging Het
Igf2r C A 17: 12,914,240 (GRCm39) C1743F probably damaging Het
Igfn1 C A 1: 135,901,185 (GRCm39) R431L probably damaging Het
Itch A G 2: 155,045,217 (GRCm39) Q507R probably benign Het
Kbtbd2 C A 6: 56,757,331 (GRCm39) R135L probably damaging Het
Kcnn2 T C 18: 45,725,446 (GRCm39) I314T probably damaging Het
Lix1 A G 17: 17,623,211 (GRCm39) D2G probably damaging Het
Lrp1b T C 2: 40,487,076 (GRCm39) Y4557C Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mcam G T 9: 44,046,473 (GRCm39) probably benign Het
Med19 G T 2: 84,508,975 (GRCm39) G63C probably damaging Het
Mfsd4b1 C T 10: 39,883,330 (GRCm39) R40H probably damaging Het
Neb C T 2: 52,146,190 (GRCm39) R2929H probably damaging Het
Nlrc5 A G 8: 95,237,908 (GRCm39) D1434G probably benign Het
Nlrp14 A T 7: 106,797,049 (GRCm39) N972I probably damaging Het
Or13a18 T C 7: 140,190,936 (GRCm39) Y278H probably damaging Het
Or14j7 A T 17: 38,235,275 (GRCm39) M273L probably benign Het
Or2h15 A T 17: 38,441,693 (GRCm39) L130Q probably damaging Het
Or4a74 A C 2: 89,439,948 (GRCm39) F166C probably damaging Het
Or8g29-ps1 A G 9: 39,200,781 (GRCm39) V135A probably benign Het
Otop1 T C 5: 38,460,158 (GRCm39) V575A probably damaging Het
Pcsk4 T C 10: 80,161,224 (GRCm39) D230G probably damaging Het
Phldb2 C A 16: 45,646,308 (GRCm39) S46I probably damaging Het
Pik3ca A T 3: 32,508,587 (GRCm39) N785I probably damaging Het
Polr2b A G 5: 77,471,485 (GRCm39) R274G probably damaging Het
Prkdc G A 16: 15,634,523 (GRCm39) probably null Het
Prune2 C T 19: 17,101,144 (GRCm39) T2216I probably benign Het
Psma3 A T 12: 71,041,156 (GRCm39) D252V probably benign Het
Rnf213 T C 11: 119,326,768 (GRCm39) V1586A Het
Ryr2 T C 13: 11,897,976 (GRCm39) T140A probably benign Het
Slc25a48 A G 13: 56,611,552 (GRCm39) I220V probably benign Het
Slc2a1 A T 4: 118,990,607 (GRCm39) E246D probably benign Het
Slc45a4 A G 15: 73,458,206 (GRCm39) Y448H probably benign Het
Sorl1 C T 9: 41,957,857 (GRCm39) V596I probably benign Het
Spag6 A C 2: 18,703,985 (GRCm39) E11A probably benign Het
Spef2 A G 15: 9,727,495 (GRCm39) probably null Het
Spon1 T C 7: 113,628,188 (GRCm39) S315P probably damaging Het
Stard3 G A 11: 98,262,931 (GRCm39) probably benign Het
Sv2c A G 13: 96,112,589 (GRCm39) M636T probably damaging Het
Syt17 T A 7: 118,033,480 (GRCm39) D172V probably damaging Het
Tcf4 A G 18: 69,766,652 (GRCm39) Y206C probably damaging Het
Tead2 G T 7: 44,880,776 (GRCm39) S318I probably benign Het
Tom1 A T 8: 75,783,883 (GRCm39) D289V probably damaging Het
Tonsl A G 15: 76,520,971 (GRCm39) probably benign Het
Tsen15 T C 1: 152,259,098 (GRCm39) I87V probably damaging Het
Usp15 A G 10: 123,007,112 (GRCm39) F123S probably damaging Het
Vmn1r220 A T 13: 23,368,258 (GRCm39) I146N possibly damaging Het
Vmn2r108 A T 17: 20,692,561 (GRCm39) N98K probably benign Het
Vmn2r71 T A 7: 85,269,788 (GRCm39) M433K probably benign Het
Vmn2r97 A T 17: 19,134,762 (GRCm39) H60L probably benign Het
Wbp4 A G 14: 79,699,486 (GRCm39) V336A probably benign Het
Zfp663 T C 2: 165,202,010 (GRCm39) probably null Het
Zpld2 A G 4: 133,922,770 (GRCm39) L521P probably damaging Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37,442,969 (GRCm39) missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37,441,566 (GRCm39) missense probably benign
IGL01325:Pcdhb4 APN 18 37,442,676 (GRCm39) missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37,441,803 (GRCm39) missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37,442,067 (GRCm39) missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37,442,057 (GRCm39) missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37,440,735 (GRCm39) missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37,442,721 (GRCm39) missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37,443,030 (GRCm39) missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37,441,569 (GRCm39) missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37,441,938 (GRCm39) missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37,442,268 (GRCm39) missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37,441,263 (GRCm39) missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37,440,795 (GRCm39) missense probably benign 0.01
R0738:Pcdhb4 UTSW 18 37,441,764 (GRCm39) missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37,442,938 (GRCm39) nonsense probably null
R0893:Pcdhb4 UTSW 18 37,442,423 (GRCm39) splice site probably null
R1932:Pcdhb4 UTSW 18 37,442,594 (GRCm39) missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37,441,921 (GRCm39) missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37,441,788 (GRCm39) missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37,441,979 (GRCm39) missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37,442,367 (GRCm39) missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37,441,065 (GRCm39) missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37,441,065 (GRCm39) missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37,441,901 (GRCm39) missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37,443,017 (GRCm39) missense probably benign
R4606:Pcdhb4 UTSW 18 37,441,705 (GRCm39) missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37,441,553 (GRCm39) missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37,441,452 (GRCm39) missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37,442,979 (GRCm39) missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37,440,819 (GRCm39) missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37,442,034 (GRCm39) missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37,442,042 (GRCm39) missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37,442,619 (GRCm39) missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37,441,482 (GRCm39) missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37,441,074 (GRCm39) missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37,442,625 (GRCm39) missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37,441,835 (GRCm39) missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37,442,292 (GRCm39) missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37,441,222 (GRCm39) missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37,442,328 (GRCm39) missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37,442,505 (GRCm39) missense probably damaging 1.00
R7614:Pcdhb4 UTSW 18 37,442,602 (GRCm39) missense probably benign 0.40
R7650:Pcdhb4 UTSW 18 37,442,667 (GRCm39) missense probably damaging 1.00
R7664:Pcdhb4 UTSW 18 37,442,293 (GRCm39) missense probably damaging 1.00
R8080:Pcdhb4 UTSW 18 37,442,349 (GRCm39) missense probably benign 0.42
R8087:Pcdhb4 UTSW 18 37,441,717 (GRCm39) missense probably damaging 1.00
R8115:Pcdhb4 UTSW 18 37,442,453 (GRCm39) missense probably damaging 0.99
R8697:Pcdhb4 UTSW 18 37,441,832 (GRCm39) missense probably benign 0.15
R8815:Pcdhb4 UTSW 18 37,442,055 (GRCm39) missense probably damaging 1.00
R9008:Pcdhb4 UTSW 18 37,440,714 (GRCm39) missense probably benign
R9225:Pcdhb4 UTSW 18 37,441,695 (GRCm39) missense possibly damaging 0.68
R9299:Pcdhb4 UTSW 18 37,442,264 (GRCm39) missense probably benign 0.02
R9390:Pcdhb4 UTSW 18 37,442,781 (GRCm39) missense possibly damaging 0.80
R9582:Pcdhb4 UTSW 18 37,441,417 (GRCm39) missense probably damaging 1.00
R9686:Pcdhb4 UTSW 18 37,442,943 (GRCm39) missense probably damaging 0.98
R9721:Pcdhb4 UTSW 18 37,442,905 (GRCm39) missense possibly damaging 0.70
Z1177:Pcdhb4 UTSW 18 37,442,966 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGATAACGCCCCAGAGTTGAC -3'
(R):5'- ACTGATGGTGCCTATGTGCAG -3'

Sequencing Primer
(F):5'- AGAGTTGACGGTCTCTACGCTC -3'
(R):5'- TGCCTATGTGCAGGGCGG -3'
Posted On 2022-03-25