Incidental Mutation 'R9278:Cyp2c67'
ID 703481
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms C730004C24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R9278 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 39608842-39649051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 39609255 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 433 (R433Q)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
AlphaFold Q569X9
Predicted Effect probably damaging
Transcript: ENSMUST00000067328
AA Change: R433Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: R433Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 93.4%
  • 10x: 93.2%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,804,008 C59S probably damaging Het
Aicda C T 6: 122,561,895 A161V possibly damaging Het
Ankrd12 C T 17: 66,037,604 E91K possibly damaging Het
Arpc2 C A 1: 74,236,882 F19L probably benign Het
Aspa T C 11: 73,324,454 K12E possibly damaging Het
Chd8 G A 14: 52,235,170 P392L probably benign Het
Cldn10 C T 14: 118,874,235 R206W probably damaging Het
Clec4b2 T A 6: 123,204,265 M203K probably damaging Het
Clec4d T C 6: 123,274,690 M177T probably benign Het
Clec4d G T 6: 123,274,692 E178* probably null Het
Cmpk2 A T 12: 26,469,569 Y73F probably benign Het
Col1a1 T A 11: 94,947,277 V845D unknown Het
Dda1 A T 8: 71,474,486 probably null Het
Ddx60 A T 8: 61,977,978 Y849F possibly damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dtwd1 C T 2: 126,164,808 T250I probably damaging Het
Efcab6 A G 15: 83,892,893 V1114A probably damaging Het
Fat4 A G 3: 38,891,022 T1355A probably benign Het
Fbxo40 T G 16: 36,969,578 D390A possibly damaging Het
Gm7534 A G 4: 134,195,459 L521P probably damaging Het
Gnaz T A 10: 74,991,605 L63Q probably benign Het
H6pd T A 4: 149,995,850 K179N probably damaging Het
Hps5 A G 7: 46,790,973 F18L probably benign Het
Hyal5 A G 6: 24,876,695 E189G probably benign Het
Ifnar1 T A 16: 91,505,125 I496N probably damaging Het
Igf2r C A 17: 12,695,353 C1743F probably damaging Het
Igfn1 C A 1: 135,973,447 R431L probably damaging Het
Itch A G 2: 155,203,297 Q507R probably benign Het
Kbtbd2 C A 6: 56,780,346 R135L probably damaging Het
Kcnn2 T C 18: 45,592,379 I314T probably damaging Het
Lix1 A G 17: 17,402,949 D2G probably damaging Het
Lrp1b T C 2: 40,597,064 Y4557C Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Med19 G T 2: 84,678,631 G63C probably damaging Het
Mfsd4b1 C T 10: 40,007,334 R40H probably damaging Het
Neb C T 2: 52,256,178 R2929H probably damaging Het
Nlrc5 A G 8: 94,511,280 D1434G probably benign Het
Nlrp14 A T 7: 107,197,842 N972I probably damaging Het
Olfr1247 A C 2: 89,609,604 F166C probably damaging Het
Olfr128 A T 17: 37,924,384 M273L probably benign Het
Olfr132 A T 17: 38,130,802 L130Q probably damaging Het
Olfr46 T C 7: 140,611,023 Y278H probably damaging Het
Olfr947-ps1 A G 9: 39,289,485 V135A probably benign Het
Otop1 T C 5: 38,302,815 V575A probably damaging Het
Pcdhb4 A G 18: 37,308,872 S412G possibly damaging Het
Pcsk4 T C 10: 80,325,390 D230G probably damaging Het
Phldb2 C A 16: 45,825,945 S46I probably damaging Het
Pik3ca A T 3: 32,454,438 N785I probably damaging Het
Polr2b A G 5: 77,323,638 R274G probably damaging Het
Prkdc G A 16: 15,816,659 probably null Het
Prune2 C T 19: 17,123,780 T2216I probably benign Het
Psma3 A T 12: 70,994,382 D252V probably benign Het
Rnf213 T C 11: 119,435,942 V1586A Het
Ryr2 T C 13: 11,883,090 T140A probably benign Het
Slc25a48 A G 13: 56,463,739 I220V probably benign Het
Slc2a1 A T 4: 119,133,410 E246D probably benign Het
Slc45a4 A G 15: 73,586,357 Y448H probably benign Het
Sorl1 C T 9: 42,046,561 V596I probably benign Het
Spag6 A C 2: 18,699,174 E11A probably benign Het
Spef2 A G 15: 9,727,409 probably null Het
Spon1 T C 7: 114,028,953 S315P probably damaging Het
Stard3 G A 11: 98,372,105 probably benign Het
Sv2c A G 13: 95,976,081 M636T probably damaging Het
Syt17 T A 7: 118,434,257 D172V probably damaging Het
Tcf4 A G 18: 69,633,581 Y206C probably damaging Het
Tead2 G T 7: 45,231,352 S318I probably benign Het
Tom1 A T 8: 75,057,255 D289V probably damaging Het
Tsen15 T C 1: 152,383,347 I87V probably damaging Het
Ttc30a2 T C 2: 75,977,031 D379G probably damaging Het
Usp15 A G 10: 123,171,207 F123S probably damaging Het
Vmn1r220 A T 13: 23,184,088 I146N possibly damaging Het
Vmn2r108 A T 17: 20,472,299 N98K probably benign Het
Vmn2r71 T A 7: 85,620,580 M433K probably benign Het
Vmn2r97 A T 17: 18,914,500 H60L probably benign Het
Wbp4 A G 14: 79,462,046 V336A probably benign Het
Zfp663 T C 2: 165,360,090 probably null Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39640008 missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39638674 missense probably benign 0.01
R8717:Cyp2c67 UTSW 19 39638711 missense probably benign 0.05
R8728:Cyp2c67 UTSW 19 39626161 missense probably damaging 1.00
R9275:Cyp2c67 UTSW 19 39609255 missense probably damaging 1.00
R9376:Cyp2c67 UTSW 19 39638734 missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCATAGCAGAATCTTTCCTCATC -3'
(R):5'- GGGAAAATATGTCTCATCTTTGTGTC -3'

Sequencing Primer
(F):5'- TCTTCATTCCACAGGGATAAAGC -3'
(R):5'- TTGTGTCTTTGCTTAACTAGATATCC -3'
Posted On 2022-03-25