Mutagenetix > Incidental Mutation

Incidental Mutation 'R9279:Tenm2'

703509

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.583) question?

Stock #

R9279 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 36068476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1082 (T1082I)

Ref Sequence

ENSEMBL: ENSMUSP00000052014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000057207
AA Change: T1082I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: T1082I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102801
AA Change: T1081I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: T1081I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163524
AA Change: T1081I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: T1081I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (50/50)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr7a5	A	T	4: 139,316,768	H225L	possibly damaging	Het
Arhgap32	C	A	9: 32,257,359	H879Q	probably benign	Het
Axin2	A	G	11: 108,942,302	I438V	possibly damaging	Het
Btbd18	T	A	2: 84,661,576	C34S	probably damaging	Het
Carns1	G	T	19: 4,166,257	T642N	possibly damaging	Het
Casp8	T	C	1: 58,844,383	I283T	probably benign	Het
Ccdc136	T	A	6: 29,421,983		probably benign	Het
Ccnk	C	A	12: 108,195,687	Q284K	unknown	Het
Ceacam12	T	A	7: 18,067,252	L52H	probably damaging	Het
Cit	G	A	5: 115,927,911	D540N	probably damaging	Het
Cntnap1	T	C	11: 101,181,295	V458A	probably damaging	Het
Col6a5	T	A	9: 105,881,777	I2077F	probably damaging	Het
Dnah2	T	C	11: 69,518,278	K425E	probably benign	Het
E330021D16Rik	A	G	6: 136,400,980	V284A	probably damaging	Het
Eya2	A	G	2: 165,687,711	S125G	probably benign	Het
Gabrg1	T	G	5: 70,777,256	M260L	probably benign	Het
Greb1	T	C	12: 16,682,152	S1603G	probably damaging	Het
Isx	A	G	8: 74,873,806	T56A	probably benign	Het
Kif2b	A	T	11: 91,577,149	S103T	probably benign	Het
Krtap26-1	T	C	16: 88,647,454	H93R	probably benign	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Mdm4	G	A	1: 132,996,678	T236M	probably damaging	Het
Mgat5	T	A	1: 127,397,611	L405Q	probably damaging	Het
Msantd1	A	G	5: 34,923,541	I272V	probably benign	Het
Ocstamp	A	G	2: 165,395,848	*499Q	probably null	Het
Olfr1	G	A	11: 73,388,963	P21L	probably benign	Het
Olfr1186	A	G	2: 88,525,867	M95V	probably benign	Het
Olfr136	G	A	17: 38,335,523	R122Q	probably damaging	Het
Olfr1448	A	T	19: 12,919,945	Y121*	probably null	Het
Olfr745	A	G	14: 50,643,036	K252E	possibly damaging	Het
Pcdh15	T	A	10: 74,625,924		probably benign	Het
Pkdrej	C	T	15: 85,816,633	G1701S	probably damaging	Het
Ppp1r9a	A	G	6: 5,113,757	T754A	probably damaging	Het
Prss8	C	A	7: 127,927,910	Q55H	probably damaging	Het
Psg20	G	T	7: 18,682,745	R149S	probably benign	Het
Ptprz1	T	G	6: 23,002,445	N1511K	probably benign	Het
Rbbp8nl	C	T	2: 180,279,101		probably null	Het
Sgk2	A	G	2: 163,013,055	D362G	probably benign	Het
Sim1	T	C	10: 50,983,700	Y553H	probably damaging	Het
Sipa1l2	T	C	8: 125,482,157	D504G	probably damaging	Het
Smad7	T	C	18: 75,369,476	V174A	possibly damaging	Het
Smarcc1	T	A	9: 110,167,724	N303K	possibly damaging	Het
Snai3	T	C	8: 122,456,299	H169R	possibly damaging	Het
Tecpr2	T	A	12: 110,929,071	S331T	possibly damaging	Het
Tle4	A	T	19: 14,452,526	I627N	probably damaging	Het
Tnxb	A	T	17: 34,679,114	N912I	possibly damaging	Het
Vmn1r238	A	T	18: 3,122,994	V140E	probably damaging	Het
Vmn1r65	G	A	7: 6,008,989	T82I	probably benign	Het
Vps13b	A	G	15: 35,572,144	K969R	probably damaging	Het
Zfp943	A	G	17: 21,990,851	R35G	possibly damaging	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCCTGGAAGAGAGATTGTTGTG -3'
(R):5'- CTTGCAAACAGCTCACCTGC -3'

Sequencing Primer
(F):5'- CCATGAATGAAAAGTGGCTGAAACC -3'
(R):5'- AACAGCTCACCTGCCAGGG -3'

Posted On

2022-03-25