Incidental Mutation 'R9279:Kif2b'
ID 703511
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Name kinesin family member 2B
Synonyms 1700063D03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock # R9279 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 91575315-91577558 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91577149 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 103 (S103T)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
AlphaFold Q8C0N1
Predicted Effect probably benign
Transcript: ENSMUST00000061019
AA Change: S103T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: S103T

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr7a5 A T 4: 139,316,768 H225L possibly damaging Het
Arhgap32 C A 9: 32,257,359 H879Q probably benign Het
Axin2 A G 11: 108,942,302 I438V possibly damaging Het
Btbd18 T A 2: 84,661,576 C34S probably damaging Het
Carns1 G T 19: 4,166,257 T642N possibly damaging Het
Casp8 T C 1: 58,844,383 I283T probably benign Het
Ccnk C A 12: 108,195,687 Q284K unknown Het
Ceacam12 T A 7: 18,067,252 L52H probably damaging Het
Cit G A 5: 115,927,911 D540N probably damaging Het
Cntnap1 T C 11: 101,181,295 V458A probably damaging Het
Col6a5 T A 9: 105,881,777 I2077F probably damaging Het
Dnah2 T C 11: 69,518,278 K425E probably benign Het
E330021D16Rik A G 6: 136,400,980 V284A probably damaging Het
Eya2 A G 2: 165,687,711 S125G probably benign Het
Gabrg1 T G 5: 70,777,256 M260L probably benign Het
Greb1 T C 12: 16,682,152 S1603G probably damaging Het
Isx A G 8: 74,873,806 T56A probably benign Het
Krtap26-1 T C 16: 88,647,454 H93R probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mdm4 G A 1: 132,996,678 T236M probably damaging Het
Mgat5 T A 1: 127,397,611 L405Q probably damaging Het
Msantd1 A G 5: 34,923,541 I272V probably benign Het
Ocstamp A G 2: 165,395,848 *499Q probably null Het
Olfr1186 A G 2: 88,525,867 M95V probably benign Het
Olfr136 G A 17: 38,335,523 R122Q probably damaging Het
Olfr1448 A T 19: 12,919,945 Y121* probably null Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Pkdrej C T 15: 85,816,633 G1701S probably damaging Het
Pkhd1l1 A G 15: 44,520,825 T1204A possibly damaging Het
Ppp1r9a A G 6: 5,113,757 T754A probably damaging Het
Prss8 C A 7: 127,927,910 Q55H probably damaging Het
Psg20 G T 7: 18,682,745 R149S probably benign Het
Ptprz1 T G 6: 23,002,445 N1511K probably benign Het
Rbbp8nl C T 2: 180,279,101 probably null Het
Sgk2 A G 2: 163,013,055 D362G probably benign Het
Sim1 T C 10: 50,983,700 Y553H probably damaging Het
Sipa1l2 T C 8: 125,482,157 D504G probably damaging Het
Smad7 T C 18: 75,369,476 V174A possibly damaging Het
Smarcc1 T A 9: 110,167,724 N303K possibly damaging Het
Snai3 T C 8: 122,456,299 H169R possibly damaging Het
Tecpr2 T A 12: 110,929,071 S331T possibly damaging Het
Tenm2 G A 11: 36,068,476 T1082I probably benign Het
Tle4 A T 19: 14,452,526 I627N probably damaging Het
Tnxb A T 17: 34,679,114 N912I possibly damaging Het
Vmn1r238 A T 18: 3,122,994 V140E probably damaging Het
Vmn1r65 G A 7: 6,008,989 T82I probably benign Het
Vps13b A G 15: 35,572,144 K969R probably damaging Het
Zfp943 A G 17: 21,990,851 R35G possibly damaging Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91576380 missense probably damaging 1.00
IGL01459:Kif2b APN 11 91577023 missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91576365 missense probably damaging 1.00
IGL02897:Kif2b APN 11 91576219 missense probably damaging 1.00
R0076:Kif2b UTSW 11 91575909 missense probably damaging 1.00
R0488:Kif2b UTSW 11 91576972 missense probably benign 0.00
R0524:Kif2b UTSW 11 91575724 missense probably benign 0.00
R0549:Kif2b UTSW 11 91576584 missense probably damaging 1.00
R0893:Kif2b UTSW 11 91575594 missense probably benign 0.16
R1677:Kif2b UTSW 11 91575972 missense probably damaging 1.00
R2025:Kif2b UTSW 11 91577346 missense probably damaging 0.99
R2185:Kif2b UTSW 11 91576971 frame shift probably null
R2290:Kif2b UTSW 11 91575696 missense probably benign 0.00
R4697:Kif2b UTSW 11 91576846 missense probably benign 0.01
R4785:Kif2b UTSW 11 91576428 missense probably benign 0.07
R5429:Kif2b UTSW 11 91577229 missense probably benign 0.03
R5555:Kif2b UTSW 11 91575460 missense probably benign 0.00
R5652:Kif2b UTSW 11 91575830 missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91577242 missense probably benign 0.28
R6101:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6105:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6450:Kif2b UTSW 11 91576366 missense probably damaging 0.99
R6862:Kif2b UTSW 11 91575915 missense probably damaging 1.00
R7097:Kif2b UTSW 11 91576824 missense probably benign 0.00
R7189:Kif2b UTSW 11 91577137 missense probably benign 0.01
R7507:Kif2b UTSW 11 91577443 missense probably benign
R7742:Kif2b UTSW 11 91576585 missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91576126 missense probably damaging 1.00
R7820:Kif2b UTSW 11 91577274 missense probably benign 0.01
R7946:Kif2b UTSW 11 91575745 missense probably benign 0.00
R8378:Kif2b UTSW 11 91576375 missense possibly damaging 0.95
R8442:Kif2b UTSW 11 91576314 missense possibly damaging 0.54
R8925:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8927:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8969:Kif2b UTSW 11 91577193 missense probably benign 0.00
R9002:Kif2b UTSW 11 91576227 missense probably benign 0.30
R9028:Kif2b UTSW 11 91577185 missense probably benign
R9039:Kif2b UTSW 11 91576305 missense possibly damaging 0.91
R9063:Kif2b UTSW 11 91575828 missense probably damaging 1.00
R9114:Kif2b UTSW 11 91575712 missense possibly damaging 0.77
Z1176:Kif2b UTSW 11 91576264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAGCTCGGATCTCTAGCTG -3'
(R):5'- AACGGATTCACCTGGCTGTG -3'

Sequencing Primer
(F):5'- TCGGATCTCTAGCTGCAGTCG -3'
(R):5'- GATTCACCTGGCTGTGGTCAC -3'
Posted On 2022-03-25