Incidental Mutation 'R9279:Cntnap1'
ID 703512
Institutional Source Beutler Lab
Gene Symbol Cntnap1
Ensembl Gene ENSMUSG00000017167
Gene Name contactin associated protein-like 1
Synonyms Nrxn4, Caspr, NCP1, p190, paranodin, shm
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock # R9279 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 101170523-101190724 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101181295 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 458 (V458A)
Ref Sequence ENSEMBL: ENSMUSP00000099398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103109]
AlphaFold O54991
Predicted Effect probably damaging
Transcript: ENSMUST00000103109
AA Change: V458A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167
AA Change: V458A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr7a5 A T 4: 139,316,768 H225L possibly damaging Het
Arhgap32 C A 9: 32,257,359 H879Q probably benign Het
Axin2 A G 11: 108,942,302 I438V possibly damaging Het
Btbd18 T A 2: 84,661,576 C34S probably damaging Het
Carns1 G T 19: 4,166,257 T642N possibly damaging Het
Casp8 T C 1: 58,844,383 I283T probably benign Het
Ccnk C A 12: 108,195,687 Q284K unknown Het
Ceacam12 T A 7: 18,067,252 L52H probably damaging Het
Cit G A 5: 115,927,911 D540N probably damaging Het
Col6a5 T A 9: 105,881,777 I2077F probably damaging Het
Dnah2 T C 11: 69,518,278 K425E probably benign Het
E330021D16Rik A G 6: 136,400,980 V284A probably damaging Het
Eya2 A G 2: 165,687,711 S125G probably benign Het
Gabrg1 T G 5: 70,777,256 M260L probably benign Het
Greb1 T C 12: 16,682,152 S1603G probably damaging Het
Isx A G 8: 74,873,806 T56A probably benign Het
Kif2b A T 11: 91,577,149 S103T probably benign Het
Krtap26-1 T C 16: 88,647,454 H93R probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mdm4 G A 1: 132,996,678 T236M probably damaging Het
Mgat5 T A 1: 127,397,611 L405Q probably damaging Het
Msantd1 A G 5: 34,923,541 I272V probably benign Het
Ocstamp A G 2: 165,395,848 *499Q probably null Het
Olfr1186 A G 2: 88,525,867 M95V probably benign Het
Olfr136 G A 17: 38,335,523 R122Q probably damaging Het
Olfr1448 A T 19: 12,919,945 Y121* probably null Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Pkdrej C T 15: 85,816,633 G1701S probably damaging Het
Pkhd1l1 A G 15: 44,520,825 T1204A possibly damaging Het
Ppp1r9a A G 6: 5,113,757 T754A probably damaging Het
Prss8 C A 7: 127,927,910 Q55H probably damaging Het
Psg20 G T 7: 18,682,745 R149S probably benign Het
Ptprz1 T G 6: 23,002,445 N1511K probably benign Het
Rbbp8nl C T 2: 180,279,101 probably null Het
Sgk2 A G 2: 163,013,055 D362G probably benign Het
Sim1 T C 10: 50,983,700 Y553H probably damaging Het
Sipa1l2 T C 8: 125,482,157 D504G probably damaging Het
Smad7 T C 18: 75,369,476 V174A possibly damaging Het
Smarcc1 T A 9: 110,167,724 N303K possibly damaging Het
Snai3 T C 8: 122,456,299 H169R possibly damaging Het
Tecpr2 T A 12: 110,929,071 S331T possibly damaging Het
Tenm2 G A 11: 36,068,476 T1082I probably benign Het
Tle4 A T 19: 14,452,526 I627N probably damaging Het
Tnxb A T 17: 34,679,114 N912I possibly damaging Het
Vmn1r238 A T 18: 3,122,994 V140E probably damaging Het
Vmn1r65 G A 7: 6,008,989 T82I probably benign Het
Vps13b A G 15: 35,572,144 K969R probably damaging Het
Zfp943 A G 17: 21,990,851 R35G possibly damaging Het
Other mutations in Cntnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Cntnap1 APN 11 101185092 missense possibly damaging 0.63
IGL00715:Cntnap1 APN 11 101183205 splice site probably benign
IGL00792:Cntnap1 APN 11 101178966 missense probably benign 0.19
IGL01063:Cntnap1 APN 11 101181788 missense probably benign 0.00
IGL01141:Cntnap1 APN 11 101178807 splice site probably benign
IGL02184:Cntnap1 APN 11 101178365 missense probably damaging 0.98
IGL02272:Cntnap1 APN 11 101178316 missense probably damaging 0.99
IGL02281:Cntnap1 APN 11 101182254 missense possibly damaging 0.86
IGL02437:Cntnap1 APN 11 101186851 missense probably damaging 1.00
IGL02456:Cntnap1 APN 11 101178129 missense probably benign 0.31
IGL02966:Cntnap1 APN 11 101184749 missense probably damaging 1.00
IGL03126:Cntnap1 APN 11 101176301 missense probably benign 0.00
IGL03294:Cntnap1 APN 11 101181682 missense possibly damaging 0.94
Penny UTSW 11 101186764 missense probably damaging 0.99
FR4304:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4304:Cntnap1 UTSW 11 101189589 unclassified probably benign
FR4342:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189579 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189594 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189566 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189580 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189576 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189582 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189590 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189585 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189588 unclassified probably benign
PIT4354001:Cntnap1 UTSW 11 101181297 missense probably damaging 1.00
PIT4466001:Cntnap1 UTSW 11 101177305 missense probably benign
R0329:Cntnap1 UTSW 11 101188309 missense probably damaging 1.00
R0556:Cntnap1 UTSW 11 101183996 missense probably benign
R0586:Cntnap1 UTSW 11 101187014 missense probably damaging 0.97
R0635:Cntnap1 UTSW 11 101183459 missense probably benign 0.05
R0789:Cntnap1 UTSW 11 101181384 splice site probably benign
R1016:Cntnap1 UTSW 11 101177507 missense probably damaging 0.99
R1085:Cntnap1 UTSW 11 101178836 missense probably benign 0.02
R1211:Cntnap1 UTSW 11 101184710 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1584:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1689:Cntnap1 UTSW 11 101188873 splice site probably null
R1758:Cntnap1 UTSW 11 101184623 missense probably damaging 1.00
R1779:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R1964:Cntnap1 UTSW 11 101178024 nonsense probably null
R1966:Cntnap1 UTSW 11 101180386 missense possibly damaging 0.89
R2070:Cntnap1 UTSW 11 101182979 missense probably damaging 1.00
R2088:Cntnap1 UTSW 11 101182547 missense probably damaging 1.00
R2118:Cntnap1 UTSW 11 101188657 missense probably benign
R3795:Cntnap1 UTSW 11 101186764 missense probably damaging 0.99
R4375:Cntnap1 UTSW 11 101182253 missense probably damaging 1.00
R4779:Cntnap1 UTSW 11 101178072 missense possibly damaging 0.91
R4832:Cntnap1 UTSW 11 101183019 missense probably damaging 1.00
R4965:Cntnap1 UTSW 11 101177425 missense possibly damaging 0.52
R4981:Cntnap1 UTSW 11 101176333 splice site probably null
R5008:Cntnap1 UTSW 11 101188741 nonsense probably null
R5399:Cntnap1 UTSW 11 101183316 missense probably benign
R5507:Cntnap1 UTSW 11 101183477 missense probably benign 0.42
R5560:Cntnap1 UTSW 11 101182435 missense probably damaging 1.00
R5589:Cntnap1 UTSW 11 101185118 missense probably benign
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6242:Cntnap1 UTSW 11 101182538 missense probably damaging 1.00
R6306:Cntnap1 UTSW 11 101184615 missense probably damaging 1.00
R6392:Cntnap1 UTSW 11 101186646 missense probably damaging 1.00
R6803:Cntnap1 UTSW 11 101177234 missense possibly damaging 0.81
R6939:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R6944:Cntnap1 UTSW 11 101182904 missense probably damaging 0.97
R7152:Cntnap1 UTSW 11 101177326 missense probably damaging 1.00
R7297:Cntnap1 UTSW 11 101188634 missense probably benign 0.01
R7347:Cntnap1 UTSW 11 101185268 missense probably damaging 1.00
R7961:Cntnap1 UTSW 11 101178295 missense probably benign
R7980:Cntnap1 UTSW 11 101188893 missense probably benign
R8307:Cntnap1 UTSW 11 101188876 missense possibly damaging 0.73
R8386:Cntnap1 UTSW 11 101182203 missense probably damaging 1.00
R8403:Cntnap1 UTSW 11 101177590 missense probably damaging 1.00
R8826:Cntnap1 UTSW 11 101186829 missense probably damaging 0.99
R9103:Cntnap1 UTSW 11 101181268 missense probably benign 0.06
R9284:Cntnap1 UTSW 11 101177311 missense probably benign
R9386:Cntnap1 UTSW 11 101185226 missense probably damaging 1.00
RF042:Cntnap1 UTSW 11 101180305 critical splice acceptor site probably benign
RF048:Cntnap1 UTSW 11 101180305 critical splice acceptor site probably benign
RF048:Cntnap1 UTSW 11 101189563 unclassified probably benign
RF049:Cntnap1 UTSW 11 101189592 unclassified probably benign
RF049:Cntnap1 UTSW 11 101189596 unclassified probably benign
RF050:Cntnap1 UTSW 11 101189592 unclassified probably benign
Z1176:Cntnap1 UTSW 11 101182898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCTACTAAACTGCTCTCCACG -3'
(R):5'- GGTCTCTCCAATACTCTCTATGTGG -3'

Sequencing Primer
(F):5'- TGATTCCATGAGGATCCAGC -3'
(R):5'- TCTATGTGGCCCCATCAGAAGTG -3'
Posted On 2022-03-25