Incidental Mutation 'R9279:Vmn1r238'
ID 703526
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Name vomeronasal 1 receptor, 238
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9279 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 3122492-3123412 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3122994 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 140 (V140E)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
AlphaFold E9Q373
Predicted Effect probably damaging
Transcript: ENSMUST00000165255
AA Change: V140E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: V140E

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr7a5 A T 4: 139,316,768 H225L possibly damaging Het
Arhgap32 C A 9: 32,257,359 H879Q probably benign Het
Axin2 A G 11: 108,942,302 I438V possibly damaging Het
Btbd18 T A 2: 84,661,576 C34S probably damaging Het
Carns1 G T 19: 4,166,257 T642N possibly damaging Het
Casp8 T C 1: 58,844,383 I283T probably benign Het
Ccnk C A 12: 108,195,687 Q284K unknown Het
Ceacam12 T A 7: 18,067,252 L52H probably damaging Het
Cit G A 5: 115,927,911 D540N probably damaging Het
Cntnap1 T C 11: 101,181,295 V458A probably damaging Het
Col6a5 T A 9: 105,881,777 I2077F probably damaging Het
Dnah2 T C 11: 69,518,278 K425E probably benign Het
E330021D16Rik A G 6: 136,400,980 V284A probably damaging Het
Eya2 A G 2: 165,687,711 S125G probably benign Het
Gabrg1 T G 5: 70,777,256 M260L probably benign Het
Greb1 T C 12: 16,682,152 S1603G probably damaging Het
Isx A G 8: 74,873,806 T56A probably benign Het
Kif2b A T 11: 91,577,149 S103T probably benign Het
Krtap26-1 T C 16: 88,647,454 H93R probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mdm4 G A 1: 132,996,678 T236M probably damaging Het
Mgat5 T A 1: 127,397,611 L405Q probably damaging Het
Msantd1 A G 5: 34,923,541 I272V probably benign Het
Ocstamp A G 2: 165,395,848 *499Q probably null Het
Olfr1186 A G 2: 88,525,867 M95V probably benign Het
Olfr136 G A 17: 38,335,523 R122Q probably damaging Het
Olfr1448 A T 19: 12,919,945 Y121* probably null Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Pkdrej C T 15: 85,816,633 G1701S probably damaging Het
Pkhd1l1 A G 15: 44,520,825 T1204A possibly damaging Het
Ppp1r9a A G 6: 5,113,757 T754A probably damaging Het
Prss8 C A 7: 127,927,910 Q55H probably damaging Het
Psg20 G T 7: 18,682,745 R149S probably benign Het
Ptprz1 T G 6: 23,002,445 N1511K probably benign Het
Rbbp8nl C T 2: 180,279,101 probably null Het
Sgk2 A G 2: 163,013,055 D362G probably benign Het
Sim1 T C 10: 50,983,700 Y553H probably damaging Het
Sipa1l2 T C 8: 125,482,157 D504G probably damaging Het
Smad7 T C 18: 75,369,476 V174A possibly damaging Het
Smarcc1 T A 9: 110,167,724 N303K possibly damaging Het
Snai3 T C 8: 122,456,299 H169R possibly damaging Het
Tecpr2 T A 12: 110,929,071 S331T possibly damaging Het
Tenm2 G A 11: 36,068,476 T1082I probably benign Het
Tle4 A T 19: 14,452,526 I627N probably damaging Het
Tnxb A T 17: 34,679,114 N912I possibly damaging Het
Vmn1r65 G A 7: 6,008,989 T82I probably benign Het
Vps13b A G 15: 35,572,144 K969R probably damaging Het
Zfp943 A G 17: 21,990,851 R35G possibly damaging Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3123243 missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3122770 missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3123124 missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3123135 missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3123358 missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3123040 nonsense probably null
R3024:Vmn1r238 UTSW 18 3123305 missense probably benign 0.13
R4291:Vmn1r238 UTSW 18 3123214 nonsense probably null
R4304:Vmn1r238 UTSW 18 3123040 nonsense probably null
R4586:Vmn1r238 UTSW 18 3123294 missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3123300 missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3123243 missense probably benign
R5430:Vmn1r238 UTSW 18 3122521 missense possibly damaging 0.63
R5834:Vmn1r238 UTSW 18 3123168 missense probably benign
R7186:Vmn1r238 UTSW 18 3122661 missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3122623 missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3122875 missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3123393 missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3122721 missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3123033 missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3123250 missense probably damaging 1.00
R8325:Vmn1r238 UTSW 18 3122529 missense probably benign 0.00
R8423:Vmn1r238 UTSW 18 3123365 nonsense probably null
R8747:Vmn1r238 UTSW 18 3123232 missense possibly damaging 0.87
R8930:Vmn1r238 UTSW 18 3123127 missense probably benign 0.03
R8932:Vmn1r238 UTSW 18 3123127 missense probably benign 0.03
R9382:Vmn1r238 UTSW 18 3122676 missense probably damaging 0.99
Z1177:Vmn1r238 UTSW 18 3122505 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTTGAGCAGGCCATGAGAC -3'
(R):5'- CCACAGACAATGTCATATTTTGGG -3'

Sequencing Primer
(F):5'- GGCCATGAGACCCAGACAG -3'
(R):5'- AAGAATTTCCTAGATGACATGGAATG -3'
Posted On 2022-03-25