Incidental Mutation 'R9280:Mmp27'
ID 703565
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R9280 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 7571396-7581885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7579811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 429 (I429L)
Ref Sequence ENSEMBL: ENSMUSP00000113231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably benign
Transcript: ENSMUST00000120900
AA Change: I429L

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: I429L

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151853
AA Change: I455L

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: I455L

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: I373L

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A C 6: 96,165,001 L354R probably damaging Het
Acrbp G T 6: 125,062,975 V514L probably damaging Het
Actl11 A G 9: 107,931,374 I965M probably damaging Het
Ank3 A T 10: 69,982,191 S1468C possibly damaging Het
Apobec3 A C 15: 79,906,881 N392T Het
Ccdc33 A T 9: 58,058,266 M591K probably benign Het
Ccdc39 T C 3: 33,816,004 E689G probably damaging Het
Cnot1 A T 8: 95,770,599 M250K probably benign Het
Ctbs A T 3: 146,454,387 Y57F probably damaging Het
Dchs2 A G 3: 83,281,948 I1540V possibly damaging Het
Dnah8 A T 17: 30,785,097 Q3651H possibly damaging Het
Doxl2 A G 6: 48,978,182 D652G possibly damaging Het
Eif2a A G 3: 58,539,588 probably benign Het
Entpd2 A G 2: 25,399,499 N331S possibly damaging Het
F830045P16Rik G A 2: 129,472,854 P168S probably damaging Het
Fam76b A T 9: 13,839,716 H302L possibly damaging Het
Fancm A G 12: 65,106,838 E1356G probably benign Het
Fat2 G A 11: 55,310,697 T517I probably benign Het
Glul T C 1: 153,907,865 C269R probably benign Het
Gm3404 C T 5: 146,525,946 H40Y possibly damaging Het
Gm6614 A G 6: 141,994,252 L175P possibly damaging Het
Grb7 T C 11: 98,454,422 F435S probably damaging Het
Ide T C 19: 37,330,402 probably benign Het
Ide A T 19: 37,318,091 Y191N Het
Ighv6-3 T A 12: 114,391,800 T90S probably damaging Het
Il23r A G 6: 67,452,426 C311R probably damaging Het
Ilf2 A G 3: 90,487,615 E390G unknown Het
Ints1 C T 5: 139,764,714 C896Y probably damaging Het
Ipcef1 T C 10: 6,900,736 E289G probably benign Het
Ispd T A 12: 36,521,976 S344R probably benign Het
Kbtbd2 G A 6: 56,779,012 R580W probably damaging Het
Kif21b T C 1: 136,171,707 probably null Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mmp8 A G 9: 7,567,291 D431G possibly damaging Het
Mpeg1 A G 19: 12,462,464 T429A probably benign Het
Mterf1a A T 5: 3,891,539 Y110N probably damaging Het
Myh4 G A 11: 67,255,309 A1398T probably damaging Het
Nr3c2 T A 8: 76,909,344 M358K probably benign Het
Olfr1002 G A 2: 85,648,160 R54* probably null Het
Olfr1162 A T 2: 88,050,114 F170Y probably damaging Het
Olfr866 A C 9: 20,027,343 S198R probably benign Het
Otof A G 5: 30,371,550 F1838S probably damaging Het
Pappa2 G A 1: 158,847,963 T1071I possibly damaging Het
Pcdhb15 A G 18: 37,474,741 D342G probably damaging Het
Pcdhgb7 T C 18: 37,753,532 L585P probably damaging Het
Pde1c A T 6: 56,137,520 S469R probably benign Het
Pla2g6 A G 15: 79,313,114 F87L probably benign Het
Rag2 A T 2: 101,629,800 M152L probably benign Het
Rasa1 C T 13: 85,288,613 A99T unknown Het
Rasgrp1 T C 2: 117,282,651 N760S probably benign Het
Rgsl1 A T 1: 153,794,152 M232K probably benign Het
Ryr1 G A 7: 29,102,964 H744Y probably damaging Het
Slc1a4 A G 11: 20,332,325 S50P probably damaging Het
Slc25a36 A C 9: 97,100,180 L34R probably damaging Het
Slc39a12 A T 2: 14,396,192 I127F probably benign Het
Sntb1 T C 15: 55,906,375 T73A probably benign Het
Tbc1d14 T C 5: 36,522,924 probably benign Het
Tll2 T A 19: 41,088,870 E819V possibly damaging Het
Trappc13 C T 13: 104,154,301 A181T probably benign Het
Trbj1-1 A G 6: 41,533,896 R11G Het
Ubash3b A C 9: 41,161,581 I12S unknown Het
Usp37 T C 1: 74,450,540 K828E probably damaging Het
Usp8 G C 2: 126,720,024 S46T unknown Het
Zfp418 A G 7: 7,181,409 T124A possibly damaging Het
Zfp72 T C 13: 74,372,684 T92A probably benign Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7573504 splice site probably benign
IGL00656:Mmp27 APN 9 7581382 missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7578899 critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7573415 missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7573297 missense probably benign 0.06
IGL01631:Mmp27 APN 9 7573288 critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7571590 missense probably benign 0.03
IGL03024:Mmp27 APN 9 7581376 missense probably benign 0.17
R0662:Mmp27 UTSW 9 7577650 missense probably benign 0.00
R0715:Mmp27 UTSW 9 7581155 splice site probably benign
R0826:Mmp27 UTSW 9 7579009 missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7579066 splice site probably null
R1793:Mmp27 UTSW 9 7571458 start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7578897 splice site probably null
R2074:Mmp27 UTSW 9 7577739 missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7577378 nonsense probably null
R2445:Mmp27 UTSW 9 7581181 missense probably benign 0.12
R2961:Mmp27 UTSW 9 7573602 missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7581194 missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R4938:Mmp27 UTSW 9 7578982 missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7572158 missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7579000 missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R5446:Mmp27 UTSW 9 7573515 splice site probably benign
R5485:Mmp27 UTSW 9 7573362 missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7579062 missense probably null 1.00
R6682:Mmp27 UTSW 9 7573605 missense probably benign 0.02
R6712:Mmp27 UTSW 9 7572176 missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7571954 missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7578230 missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7577317 missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7579001 missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7578984 missense probably damaging 0.97
R8185:Mmp27 UTSW 9 7573491 missense unknown
R8537:Mmp27 UTSW 9 7579775 missense probably benign 0.00
R9039:Mmp27 UTSW 9 7581249 missense probably benign 0.01
R9087:Mmp27 UTSW 9 7579857 missense probably damaging 1.00
R9188:Mmp27 UTSW 9 7579791 missense possibly damaging 0.55
R9367:Mmp27 UTSW 9 7573549 missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7573298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGGTGTTTCTCTCTACCAGGC -3'
(R):5'- AGTCAGTTTAGCACTTGTTGGC -3'

Sequencing Primer
(F):5'- AGGCCTGCTCAGTTCCCATAATG -3'
(R):5'- ATGTCTACAGGGGTAATGCCTAC -3'
Posted On 2022-03-25