Incidental Mutation 'R9280:Ccdc33'
ID 703569
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9280 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 58028677-58118823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58058266 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 591 (M591K)
Ref Sequence ENSEMBL: ENSMUSP00000096279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000215944]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042205
AA Change: M406K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: M406K

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
AA Change: M591K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: M591K

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119665
AA Change: M406K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: M406K

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215944
AA Change: M591K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A C 6: 96,165,001 L354R probably damaging Het
Acrbp G T 6: 125,062,975 V514L probably damaging Het
Actl11 A G 9: 107,931,374 I965M probably damaging Het
Ank3 A T 10: 69,982,191 S1468C possibly damaging Het
Apobec3 A C 15: 79,906,881 N392T Het
Ccdc39 T C 3: 33,816,004 E689G probably damaging Het
Cnot1 A T 8: 95,770,599 M250K probably benign Het
Ctbs A T 3: 146,454,387 Y57F probably damaging Het
Dchs2 A G 3: 83,281,948 I1540V possibly damaging Het
Dnah8 A T 17: 30,785,097 Q3651H possibly damaging Het
Doxl2 A G 6: 48,978,182 D652G possibly damaging Het
Entpd2 A G 2: 25,399,499 N331S possibly damaging Het
F830045P16Rik G A 2: 129,472,854 P168S probably damaging Het
Fam76b A T 9: 13,839,716 H302L possibly damaging Het
Fancm A G 12: 65,106,838 E1356G probably benign Het
Fat2 G A 11: 55,310,697 T517I probably benign Het
Glul T C 1: 153,907,865 C269R probably benign Het
Gm3404 C T 5: 146,525,946 H40Y possibly damaging Het
Gm6614 A G 6: 141,994,252 L175P possibly damaging Het
Grb7 T C 11: 98,454,422 F435S probably damaging Het
Ide A T 19: 37,318,091 Y191N Het
Ighv6-3 T A 12: 114,391,800 T90S probably damaging Het
Il23r A G 6: 67,452,426 C311R probably damaging Het
Ilf2 A G 3: 90,487,615 E390G unknown Het
Ints1 C T 5: 139,764,714 C896Y probably damaging Het
Ipcef1 T C 10: 6,900,736 E289G probably benign Het
Ispd T A 12: 36,521,976 S344R probably benign Het
Kbtbd2 G A 6: 56,779,012 R580W probably damaging Het
Kif21b T C 1: 136,171,707 probably null Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mmp27 A T 9: 7,579,811 I429L probably benign Het
Mmp8 A G 9: 7,567,291 D431G possibly damaging Het
Mpeg1 A G 19: 12,462,464 T429A probably benign Het
Mterf1a A T 5: 3,891,539 Y110N probably damaging Het
Myh4 G A 11: 67,255,309 A1398T probably damaging Het
Nr3c2 T A 8: 76,909,344 M358K probably benign Het
Olfr1002 G A 2: 85,648,160 R54* probably null Het
Olfr1162 A T 2: 88,050,114 F170Y probably damaging Het
Olfr866 A C 9: 20,027,343 S198R probably benign Het
Otof A G 5: 30,371,550 F1838S probably damaging Het
Pappa2 G A 1: 158,847,963 T1071I possibly damaging Het
Pcdhb15 A G 18: 37,474,741 D342G probably damaging Het
Pcdhgb7 T C 18: 37,753,532 L585P probably damaging Het
Pde1c A T 6: 56,137,520 S469R probably benign Het
Pla2g6 A G 15: 79,313,114 F87L probably benign Het
Rag2 A T 2: 101,629,800 M152L probably benign Het
Rasa1 C T 13: 85,288,613 A99T unknown Het
Rasgrp1 T C 2: 117,282,651 N760S probably benign Het
Rgsl1 A T 1: 153,794,152 M232K probably benign Het
Ryr1 G A 7: 29,102,964 H744Y probably damaging Het
Slc1a4 A G 11: 20,332,325 S50P probably damaging Het
Slc25a36 A C 9: 97,100,180 L34R probably damaging Het
Slc39a12 A T 2: 14,396,192 I127F probably benign Het
Sntb1 T C 15: 55,906,375 T73A probably benign Het
Tll2 T A 19: 41,088,870 E819V possibly damaging Het
Trappc13 C T 13: 104,154,301 A181T probably benign Het
Trbj1-1 A G 6: 41,533,896 R11G Het
Ubash3b A C 9: 41,161,581 I12S unknown Het
Usp37 T C 1: 74,450,540 K828E probably damaging Het
Usp8 G C 2: 126,720,024 S46T unknown Het
Zfp418 A G 7: 7,181,409 T124A possibly damaging Het
Zfp72 T C 13: 74,372,684 T92A probably benign Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 splice site probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
R7655:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 58069091 missense probably benign
R8215:Ccdc33 UTSW 9 58032712 missense probably benign 0.18
R9139:Ccdc33 UTSW 9 58076559 missense probably benign 0.04
R9204:Ccdc33 UTSW 9 58031105 missense probably benign 0.33
R9297:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9318:Ccdc33 UTSW 9 58086593 missense possibly damaging 0.85
R9361:Ccdc33 UTSW 9 58117625 missense possibly damaging 0.96
RF003:Ccdc33 UTSW 9 58058291 missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58117416 missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58118585 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCCATGAGAGTCTACCCAAGAG -3'
(R):5'- CACCATGGAAGGACAGGTTC -3'

Sequencing Primer
(F):5'- AAGGGGGTCACACCTTCATTC -3'
(R):5'- GAAGGACAGGTTCAAAGTCTCTCTC -3'
Posted On 2022-03-25