Incidental Mutation 'R0751:Lcp1'
ID 70358
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Name lymphocyte cytosolic protein 1
Synonyms L-fimbrin, L-plastin, D14Ertd310e, Pls2
MMRRC Submission 038931-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0751 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 75368545-75468282 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75436827 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 58 (M58L)
Ref Sequence ENSEMBL: ENSMUSP00000117984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122840] [ENSMUST00000124499] [ENSMUST00000125833] [ENSMUST00000131802] [ENSMUST00000134114] [ENSMUST00000145303] [ENSMUST00000143539]
AlphaFold Q61233
Predicted Effect probably benign
Transcript: ENSMUST00000122840
AA Change: M58L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117984
Gene: ENSMUSG00000021998
AA Change: M58L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124499
AA Change: M58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: M58L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125833
AA Change: M58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116033
Gene: ENSMUSG00000021998
AA Change: M58L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130510
Predicted Effect probably benign
Transcript: ENSMUST00000131802
AA Change: M58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: M58L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134114
AA Change: M58L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998
AA Change: M58L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145303
AA Change: M58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: M58L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143539
AA Change: M58L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998
AA Change: M58L

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 76 4.45e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161819
Meta Mutation Damage Score 0.0857 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T A 4: 132,792,707 (GRCm39) M1316K probably benign Het
Alox12 T C 11: 70,137,776 (GRCm39) I455V probably benign Het
Ankrd28 A G 14: 31,486,225 (GRCm39) L89P probably damaging Het
Aqp9 A T 9: 71,045,487 (GRCm39) C41S probably damaging Het
Arhgap17 T C 7: 122,913,913 (GRCm39) Y199C probably damaging Het
Aspm A T 1: 139,384,636 (GRCm39) probably benign Het
Cacfd1 T C 2: 26,908,993 (GRCm39) probably null Het
Cd33 T C 7: 43,181,545 (GRCm39) D205G probably damaging Het
Chadl T C 15: 81,577,258 (GRCm39) S198G probably benign Het
Chtf8 A G 8: 107,613,109 (GRCm39) probably null Het
Clec4a4 G T 6: 122,989,671 (GRCm39) W104L probably benign Het
Clock A T 5: 76,377,208 (GRCm39) I696K possibly damaging Het
Crtc2 T A 3: 90,169,940 (GRCm39) Y445* probably null Het
Dapk1 A T 13: 60,844,112 (GRCm39) I44F probably damaging Het
Dcbld2 T A 16: 58,270,204 (GRCm39) probably null Het
Derl2 T C 11: 70,905,373 (GRCm39) probably null Het
Dnah7c A G 1: 46,505,065 (GRCm39) T154A probably benign Het
Dnmt3b T A 2: 153,516,762 (GRCm39) probably null Het
Dusp3 A T 11: 101,872,554 (GRCm39) S106T probably benign Het
Eftud2 A G 11: 102,730,079 (GRCm39) V897A probably damaging Het
Eif3l T A 15: 78,959,966 (GRCm39) probably null Het
Fbxo33 A C 12: 59,265,878 (GRCm39) F130V probably damaging Het
Ffar3 T A 7: 30,554,529 (GRCm39) N264Y probably damaging Het
Fig4 T C 10: 41,148,978 (GRCm39) D158G probably damaging Het
Fyco1 A G 9: 123,648,218 (GRCm39) F1239L probably damaging Het
Gabra2 A G 5: 71,249,442 (GRCm39) probably benign Het
Gabra6 C A 11: 42,205,844 (GRCm39) R336S probably benign Het
Hkdc1 T C 10: 62,234,452 (GRCm39) D581G probably damaging Het
Ift70a2 C T 2: 75,808,375 (GRCm39) A46T probably damaging Het
Iqgap1 A G 7: 80,375,321 (GRCm39) probably benign Het
Larp4b T C 13: 9,216,345 (GRCm39) probably benign Het
Lrrc8a T C 2: 30,146,362 (GRCm39) V392A possibly damaging Het
Mavs A T 2: 131,088,684 (GRCm39) Y496F probably damaging Het
Mpi A T 9: 57,457,897 (GRCm39) S102T probably damaging Het
Mroh9 G A 1: 162,893,693 (GRCm39) R161W possibly damaging Het
Myo1h A T 5: 114,458,747 (GRCm39) S161C probably damaging Het
Napg T G 18: 63,127,409 (GRCm39) H204Q probably benign Het
Nelfcd C A 2: 174,264,807 (GRCm39) A182D probably benign Het
Ntsr2 G T 12: 16,704,031 (GRCm39) K91N probably damaging Het
Obscn A G 11: 58,972,645 (GRCm39) S2134P probably damaging Het
Ogfod2 G A 5: 124,251,539 (GRCm39) probably benign Het
Or13a19 G A 7: 139,903,238 (GRCm39) V209I probably benign Het
Or1e26 G T 11: 73,479,970 (GRCm39) T198K probably benign Het
Pcdha8 T C 18: 37,127,123 (GRCm39) V535A probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pik3r1 T C 13: 101,822,866 (GRCm39) probably null Het
Pimreg C A 11: 71,933,939 (GRCm39) Q22K probably benign Het
Pld5 A G 1: 175,872,462 (GRCm39) I225T probably damaging Het
Plxnc1 T C 10: 94,667,195 (GRCm39) probably benign Het
Ppip5k2 A T 1: 97,677,377 (GRCm39) C306* probably null Het
Ptprc A G 1: 138,020,668 (GRCm39) Y588H probably damaging Het
Rac2 T G 15: 78,450,145 (GRCm39) D65A possibly damaging Het
Rgl3 A G 9: 21,888,676 (GRCm39) probably null Het
Serpinb1a T C 13: 33,027,199 (GRCm39) K248E probably benign Het
Serpinb9e A C 13: 33,443,757 (GRCm39) E259A probably benign Het
Slc12a4 A T 8: 106,678,532 (GRCm39) V266E probably damaging Het
Slc8b1 A G 5: 120,662,260 (GRCm39) probably benign Het
Spink6 T C 18: 44,204,605 (GRCm39) probably benign Het
Spta1 G A 1: 174,012,256 (GRCm39) R354H probably damaging Het
Ssb T A 2: 69,700,909 (GRCm39) S330T probably benign Het
Stard9 G T 2: 120,527,966 (GRCm39) V1408F probably benign Het
Sumf2 A T 5: 129,878,846 (GRCm39) T61S probably benign Het
Sypl2 T C 3: 108,124,072 (GRCm39) T157A probably damaging Het
Tgfbr3 A T 5: 107,287,749 (GRCm39) D483E probably damaging Het
Tnrc6a A G 7: 122,769,563 (GRCm39) N451S possibly damaging Het
Tradd T C 8: 105,986,403 (GRCm39) E123G probably damaging Het
Trim36 T C 18: 46,329,318 (GRCm39) T41A probably damaging Het
Ttll7 C T 3: 146,645,746 (GRCm39) P535S probably damaging Het
Ubr4 C T 4: 139,164,509 (GRCm39) probably benign Het
Uqcc5 G T 14: 30,810,953 (GRCm39) probably benign Het
Vmn1r195 A G 13: 22,463,181 (GRCm39) Y217C probably damaging Het
Vmn2r63 A C 7: 42,577,459 (GRCm39) F360V probably damaging Het
Vmn2r78 G A 7: 86,603,588 (GRCm39) V589M possibly damaging Het
Vmn2r-ps158 A G 7: 42,696,833 (GRCm39) Y630C probably damaging Het
Vrk2 A G 11: 26,433,331 (GRCm39) probably benign Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75,464,533 (GRCm39) critical splice donor site probably null
IGL01768:Lcp1 APN 14 75,461,573 (GRCm39) missense probably benign 0.40
IGL01801:Lcp1 APN 14 75,436,815 (GRCm39) missense probably benign 0.10
IGL01940:Lcp1 APN 14 75,453,805 (GRCm39) missense probably benign 0.17
IGL02135:Lcp1 APN 14 75,437,926 (GRCm39) missense probably benign 0.00
IGL02185:Lcp1 APN 14 75,466,740 (GRCm39) missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75,461,536 (GRCm39) missense probably benign 0.04
IGL02604:Lcp1 APN 14 75,461,566 (GRCm39) missense probably benign 0.11
R0244:Lcp1 UTSW 14 75,464,441 (GRCm39) missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75,436,860 (GRCm39) missense probably null 0.59
R0313:Lcp1 UTSW 14 75,436,873 (GRCm39) missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
R0811:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R0812:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R1200:Lcp1 UTSW 14 75,466,742 (GRCm39) missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75,436,884 (GRCm39) critical splice donor site probably null
R1915:Lcp1 UTSW 14 75,436,737 (GRCm39) missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75,437,841 (GRCm39) missense probably benign 0.01
R2064:Lcp1 UTSW 14 75,435,515 (GRCm39) critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75,443,569 (GRCm39) missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75,452,620 (GRCm39) missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75,452,608 (GRCm39) missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75,437,848 (GRCm39) missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75,437,929 (GRCm39) missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75,445,911 (GRCm39) nonsense probably null
R5539:Lcp1 UTSW 14 75,466,738 (GRCm39) missense probably benign 0.08
R5561:Lcp1 UTSW 14 75,449,948 (GRCm39) missense probably benign 0.01
R5724:Lcp1 UTSW 14 75,464,422 (GRCm39) missense probably benign 0.18
R5989:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R6731:Lcp1 UTSW 14 75,443,629 (GRCm39) missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75,447,946 (GRCm39) missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75,437,871 (GRCm39) missense probably benign 0.12
R7698:Lcp1 UTSW 14 75,443,651 (GRCm39) nonsense probably null
R9780:Lcp1 UTSW 14 75,440,178 (GRCm39) missense probably damaging 1.00
S24628:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75,464,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGTTTCTGCCTCTATCTGGGTC -3'
(R):5'- CTGTACCAACGAGCCAGGAAGG -3'

Sequencing Primer
(F):5'- AGACCCATGCCTGGTCATC -3'
(R):5'- AAGGGACGGATCGCCTC -3'
Posted On 2013-09-30