Incidental Mutation 'R9281:Mllt3'
ID 703611
Institutional Source Beutler Lab
Gene Symbol Mllt3
Ensembl Gene ENSMUSG00000028496
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms Af9, D4Ertd321e, 2610012I03Rik, 3830408D16Rik, 2210011H10Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9281 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 87769925-88033364 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 87789329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 464 (H464Q)
Ref Sequence ENSEMBL: ENSMUSP00000077232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078090] [ENSMUST00000126353] [ENSMUST00000148059] [ENSMUST00000149357]
AlphaFold A2AM29
Predicted Effect probably benign
Transcript: ENSMUST00000078090
AA Change: H464Q

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077232
Gene: ENSMUSG00000028496
AA Change: H464Q

DomainStartEndE-ValueType
Pfam:YEATS 29 110 2.3e-29 PFAM
SCOP:d1l9ha_ 126 173 9e-3 SMART
internal_repeat_1 195 214 9.17e-5 PROSPERO
internal_repeat_1 206 225 9.17e-5 PROSPERO
low complexity region 226 246 N/A INTRINSIC
low complexity region 291 314 N/A INTRINSIC
SCOP:d1qbkb_ 315 467 7e-4 SMART
PDB:2LM0|A 485 569 3e-48 PDB
Predicted Effect unknown
Transcript: ENSMUST00000126353
AA Change: H57Q
SMART Domains Protein: ENSMUSP00000129523
Gene: ENSMUSG00000028496
AA Change: H57Q

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
PDB:2LM0|A 76 138 1e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000148059
SMART Domains Protein: ENSMUSP00000131095
Gene: ENSMUSG00000028496

DomainStartEndE-ValueType
PDB:2LM0|A 1 54 6e-34 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000149357
AA Change: H57Q

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128366
Gene: ENSMUSG00000028496
AA Change: H57Q

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
PDB:2LM0|A 76 162 4e-54 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: About 50% of homozygous null mice die perinatally while the remaining 50% become runted and die within two weeks of birth with severe defects of the axial skeleton, including anterior homeotic transformation of the cervical and thoracic regions, a deformed atlas and an extra cervical vertebra. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,624,760 I102M possibly damaging Het
2700049A03Rik G A 12: 71,158,913 V444I possibly damaging Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Ano1 A T 7: 144,595,581 Y848N probably damaging Het
Arap2 C T 5: 62,749,505 R57H probably damaging Het
Atp10b C T 11: 43,225,631 T935I probably benign Het
Bcl11b A G 12: 107,915,998 L686P possibly damaging Het
Bmp5 T C 9: 75,776,574 V161A probably benign Het
C1qtnf3 A G 15: 10,978,521 E196G probably benign Het
Cacng8 T A 7: 3,412,092 F130L probably damaging Het
Cap1 A G 4: 122,872,433 M4T probably benign Het
Ccdc57 T C 11: 120,860,587 K886E probably benign Het
Cdhr2 A C 13: 54,733,890 T1112P possibly damaging Het
Clcn4 A T 7: 7,291,814 M316K probably benign Het
Col22a1 A T 15: 71,861,071 D1099E unknown Het
Csmd3 A C 15: 47,596,876 N2595K Het
Ctdspl2 A G 2: 122,010,582 H451R probably benign Het
Cybrd1 A T 2: 71,138,391 T203S probably benign Het
Dhx29 A G 13: 112,941,706 N312S possibly damaging Het
Dhx30 A T 9: 110,100,915 S38T probably benign Het
Ercc8 G T 13: 108,183,830 A317S probably benign Het
Fndc3a T C 14: 72,561,657 T629A probably benign Het
Frmpd1 G T 4: 45,284,127 A983S probably benign Het
Gm14325 T A 2: 177,831,804 Y495F probably damaging Het
Gm5773 A T 3: 93,773,584 T188S probably benign Het
Gpsm1 C A 2: 26,324,476 N243K probably damaging Het
Inpp4a C G 1: 37,371,769 H339Q probably damaging Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Kdm4a A G 4: 118,138,531 V1003A probably damaging Het
Lrrc25 T A 8: 70,620,596 M276K probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mcmdc2 G A 1: 9,924,200 G406D probably damaging Het
Mfhas1 G T 8: 35,590,797 A809S probably benign Het
Mier2 A T 10: 79,542,460 D376E probably benign Het
Myo6 T A 9: 80,254,882 Y300* probably null Het
Myzap T C 9: 71,586,200 D31G unknown Het
Nfatc1 T C 18: 80,697,975 Y270C probably damaging Het
Nsd3 T C 8: 25,662,945 S434P probably benign Het
Olfr1341 A G 4: 118,709,395 probably benign Het
Olfr385 T A 11: 73,589,307 M144L probably benign Het
Osbp2 T A 11: 3,863,375 T165S probably benign Het
Plxna1 A G 6: 89,323,331 V1590A probably damaging Het
Pramel7 A G 2: 87,491,151 L180P probably damaging Het
Prkd1 C T 12: 50,489,975 D109N probably benign Het
Ptger3 A G 3: 157,567,453 M146V probably benign Het
Pts A G 9: 50,522,553 V96A probably damaging Het
Rab11fip5 T C 6: 85,341,852 E685G probably benign Het
Rab27a C T 9: 73,084,996 T102I probably damaging Het
Reln A G 5: 21,948,547 L2253P probably damaging Het
Rock1 C T 18: 10,080,479 A1022T probably benign Het
Rspry1 T A 8: 94,636,631 N259K probably damaging Het
Sdha A T 13: 74,323,937 Y604* probably null Het
Skiv2l2 A T 13: 112,909,909 C302* probably null Het
Slc12a6 A G 2: 112,334,409 N151S probably benign Het
Slc26a5 T A 5: 21,814,053 D596V probably benign Het
Snrpa A G 7: 27,191,626 V140A probably benign Het
Spta1 T G 1: 174,219,878 V1696G probably damaging Het
St13 A T 15: 81,377,726 D179E probably damaging Het
Stpg4 T C 17: 87,395,243 D182G probably benign Het
Synm A T 7: 67,736,300 L538* probably null Het
Tigar A T 6: 127,091,194 L87H probably damaging Het
Tmem67 C A 4: 12,079,962 V110F possibly damaging Het
Trav6n-5 T A 14: 53,105,287 L94* probably null Het
Ttf1 A G 2: 29,065,890 H422R probably benign Het
Ttn A G 2: 76,789,582 V15914A probably damaging Het
Vmn2r13 C A 5: 109,156,087 C826F probably damaging Het
Wdr60 G A 12: 116,248,057 R277* probably null Het
Wwc1 C G 11: 35,889,384 G248A probably benign Het
Zfp120 G A 2: 150,117,695 H258Y probably damaging Het
Zfp142 A G 1: 74,568,572 Y1681H probably damaging Het
Zkscan3 A G 13: 21,394,875 L150P possibly damaging Het
Zscan4-ps1 G T 7: 11,065,662 F433L possibly damaging Het
Other mutations in Mllt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Mllt3 APN 4 87791881 missense probably benign 0.00
IGL01078:Mllt3 APN 4 87880060 splice site probably benign
IGL01337:Mllt3 APN 4 87840820 missense probably damaging 0.99
IGL02664:Mllt3 APN 4 88031623 missense probably damaging 1.00
PIT4504001:Mllt3 UTSW 4 87774087 missense probably damaging 1.00
R0226:Mllt3 UTSW 4 87840732 missense probably benign 0.00
R0415:Mllt3 UTSW 4 87841339 utr 3 prime probably benign
R0540:Mllt3 UTSW 4 87841044 missense possibly damaging 0.73
R0618:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R0932:Mllt3 UTSW 4 87789384 missense probably damaging 0.99
R1713:Mllt3 UTSW 4 87783664 missense probably damaging 1.00
R4748:Mllt3 UTSW 4 87840781 missense possibly damaging 0.60
R4928:Mllt3 UTSW 4 87782405 splice site probably null
R5086:Mllt3 UTSW 4 87789298 missense probably damaging 0.99
R5186:Mllt3 UTSW 4 87840995 missense probably benign 0.00
R5359:Mllt3 UTSW 4 87840927 missense probably benign 0.21
R5371:Mllt3 UTSW 4 87840856 missense possibly damaging 0.64
R5713:Mllt3 UTSW 4 87841211 missense probably benign 0.01
R5787:Mllt3 UTSW 4 87840820 missense probably damaging 0.99
R6346:Mllt3 UTSW 4 87841208 missense probably damaging 1.00
R6462:Mllt3 UTSW 4 87774101 missense probably damaging 1.00
R6621:Mllt3 UTSW 4 87840797 missense possibly damaging 0.66
R6629:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R7380:Mllt3 UTSW 4 87791943 missense possibly damaging 0.85
R7600:Mllt3 UTSW 4 87841219 missense probably benign 0.07
R8045:Mllt3 UTSW 4 87841113 missense probably damaging 1.00
R8871:Mllt3 UTSW 4 87841315 utr 3 prime probably benign
R9300:Mllt3 UTSW 4 87774047 nonsense probably null
R9341:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
R9343:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
R9544:Mllt3 UTSW 4 87841181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAGTGCTTTTACCCCATG -3'
(R):5'- GTACCAACAGATGCCTGCAG -3'

Sequencing Primer
(F):5'- CATGTGCCTAATGCTAAGCTTG -3'
(R):5'- CAACAGATGCCTGCAGTTGTG -3'
Posted On 2022-03-25