Incidental Mutation 'R9281:Reln'
ID 703616
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R9281 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 21884454-22344702 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21948547 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 2253 (L2253P)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: L2253P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: L2253P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: L2253P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: L2253P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,624,760 (GRCm38) I102M possibly damaging Het
2700049A03Rik G A 12: 71,158,913 (GRCm38) V444I possibly damaging Het
Afdn T A 17: 13,804,008 (GRCm38) C59S probably damaging Het
Ano1 A T 7: 144,595,581 (GRCm38) Y848N probably damaging Het
Arap2 C T 5: 62,749,505 (GRCm38) R57H probably damaging Het
Atp10b C T 11: 43,225,631 (GRCm38) T935I probably benign Het
Bcl11b A G 12: 107,915,998 (GRCm38) L686P possibly damaging Het
Bmp5 T C 9: 75,776,574 (GRCm38) V161A probably benign Het
C1qtnf3 A G 15: 10,978,521 (GRCm38) E196G probably benign Het
Cacng8 T A 7: 3,412,092 (GRCm38) F130L probably damaging Het
Cap1 A G 4: 122,872,433 (GRCm38) M4T probably benign Het
Ccdc57 T C 11: 120,860,587 (GRCm38) K886E probably benign Het
Cdhr2 A C 13: 54,733,890 (GRCm38) T1112P possibly damaging Het
Clcn4 A T 7: 7,291,814 (GRCm38) M316K probably benign Het
Col22a1 A T 15: 71,861,071 (GRCm38) D1099E unknown Het
Csmd3 A C 15: 47,596,876 (GRCm38) N2595K Het
Ctdspl2 A G 2: 122,010,582 (GRCm38) H451R probably benign Het
Cybrd1 A T 2: 71,138,391 (GRCm38) T203S probably benign Het
Dhx29 A G 13: 112,941,706 (GRCm38) N312S possibly damaging Het
Dhx30 A T 9: 110,100,915 (GRCm38) S38T probably benign Het
Ercc8 G T 13: 108,183,830 (GRCm38) A317S probably benign Het
Fndc3a T C 14: 72,561,657 (GRCm38) T629A probably benign Het
Frmpd1 G T 4: 45,284,127 (GRCm38) A983S probably benign Het
Gm14325 T A 2: 177,831,804 (GRCm38) Y495F probably damaging Het
Gm5773 A T 3: 93,773,584 (GRCm38) T188S probably benign Het
Gpsm1 C A 2: 26,324,476 (GRCm38) N243K probably damaging Het
Inpp4a C G 1: 37,371,769 (GRCm38) H339Q probably damaging Het
Kat2b A G 17: 53,624,397 (GRCm38) D141G probably benign Het
Kdm4a A G 4: 118,138,531 (GRCm38) V1003A probably damaging Het
Lrrc25 T A 8: 70,620,596 (GRCm38) M276K probably benign Het
Ltbp2 G A 12: 84,791,090 (GRCm38) P1192L probably benign Het
Mcmdc2 G A 1: 9,924,200 (GRCm38) G406D probably damaging Het
Mfhas1 G T 8: 35,590,797 (GRCm38) A809S probably benign Het
Mier2 A T 10: 79,542,460 (GRCm38) D376E probably benign Het
Mllt3 A C 4: 87,789,329 (GRCm38) H464Q probably benign Het
Myo6 T A 9: 80,254,882 (GRCm38) Y300* probably null Het
Myzap T C 9: 71,586,200 (GRCm38) D31G unknown Het
Nfatc1 T C 18: 80,697,975 (GRCm38) Y270C probably damaging Het
Nsd3 T C 8: 25,662,945 (GRCm38) S434P probably benign Het
Olfr1341 A G 4: 118,709,395 (GRCm38) probably benign Het
Olfr385 T A 11: 73,589,307 (GRCm38) M144L probably benign Het
Osbp2 T A 11: 3,863,375 (GRCm38) T165S probably benign Het
Plxna1 A G 6: 89,323,331 (GRCm38) V1590A probably damaging Het
Pramel7 A G 2: 87,491,151 (GRCm38) L180P probably damaging Het
Prkd1 C T 12: 50,489,975 (GRCm38) D109N probably benign Het
Ptger3 A G 3: 157,567,453 (GRCm38) M146V probably benign Het
Pts A G 9: 50,522,553 (GRCm38) V96A probably damaging Het
Rab11fip5 T C 6: 85,341,852 (GRCm38) E685G probably benign Het
Rab27a C T 9: 73,084,996 (GRCm38) T102I probably damaging Het
Rock1 C T 18: 10,080,479 (GRCm38) A1022T probably benign Het
Rspry1 T A 8: 94,636,631 (GRCm38) N259K probably damaging Het
Sdha A T 13: 74,323,937 (GRCm38) Y604* probably null Het
Skiv2l2 A T 13: 112,909,909 (GRCm38) C302* probably null Het
Slc12a6 A G 2: 112,334,409 (GRCm38) N151S probably benign Het
Slc26a5 T A 5: 21,814,053 (GRCm38) D596V probably benign Het
Snrpa A G 7: 27,191,626 (GRCm38) V140A probably benign Het
Spta1 T G 1: 174,219,878 (GRCm38) V1696G probably damaging Het
St13 A T 15: 81,377,726 (GRCm38) D179E probably damaging Het
Stpg4 T C 17: 87,395,243 (GRCm38) D182G probably benign Het
Synm A T 7: 67,736,300 (GRCm38) L538* probably null Het
Tigar A T 6: 127,091,194 (GRCm38) L87H probably damaging Het
Tmem67 C A 4: 12,079,962 (GRCm38) V110F possibly damaging Het
Trav6n-5 T A 14: 53,105,287 (GRCm38) L94* probably null Het
Ttf1 A G 2: 29,065,890 (GRCm38) H422R probably benign Het
Ttn A G 2: 76,789,582 (GRCm38) V15914A probably damaging Het
Vmn2r13 C A 5: 109,156,087 (GRCm38) C826F probably damaging Het
Wdr60 G A 12: 116,248,057 (GRCm38) R277* probably null Het
Wwc1 C G 11: 35,889,384 (GRCm38) G248A probably benign Het
Zfp120 G A 2: 150,117,695 (GRCm38) H258Y probably damaging Het
Zfp142 A G 1: 74,568,572 (GRCm38) Y1681H probably damaging Het
Zkscan3 A G 13: 21,394,875 (GRCm38) L150P possibly damaging Het
Zscan4-ps1 G T 7: 11,065,662 (GRCm38) F433L possibly damaging Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL00091:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL00432:Reln APN 5 22,010,127 (GRCm38) missense probably damaging 1.00
IGL00433:Reln APN 5 22,045,009 (GRCm38) missense probably damaging 1.00
IGL00576:Reln APN 5 22,154,950 (GRCm38) missense probably benign 0.01
IGL00755:Reln APN 5 22,060,380 (GRCm38) missense probably damaging 0.98
IGL00777:Reln APN 5 22,018,850 (GRCm38) critical splice donor site probably null
IGL00900:Reln APN 5 21,980,117 (GRCm38) missense probably damaging 0.98
IGL01067:Reln APN 5 21,979,666 (GRCm38) missense probably damaging 1.00
IGL01104:Reln APN 5 21,986,967 (GRCm38) missense probably damaging 0.99
IGL01141:Reln APN 5 21,969,033 (GRCm38) missense probably damaging 1.00
IGL01141:Reln APN 5 21,919,069 (GRCm38) missense probably damaging 1.00
IGL01333:Reln APN 5 22,171,251 (GRCm38) missense probably damaging 0.99
IGL01341:Reln APN 5 21,969,079 (GRCm38) missense probably damaging 1.00
IGL01354:Reln APN 5 21,919,175 (GRCm38) nonsense probably null
IGL01361:Reln APN 5 21,919,021 (GRCm38) missense probably benign 0.06
IGL01446:Reln APN 5 21,969,317 (GRCm38) missense probably damaging 0.99
IGL01448:Reln APN 5 22,040,405 (GRCm38) missense probably benign 0.40
IGL01612:Reln APN 5 21,896,930 (GRCm38) missense probably damaging 0.99
IGL01695:Reln APN 5 21,920,438 (GRCm38) missense probably damaging 1.00
IGL01718:Reln APN 5 21,947,514 (GRCm38) missense possibly damaging 0.60
IGL01749:Reln APN 5 22,344,246 (GRCm38) nonsense probably null
IGL01875:Reln APN 5 21,904,717 (GRCm38) missense probably benign
IGL02013:Reln APN 5 21,950,879 (GRCm38) missense probably damaging 1.00
IGL02031:Reln APN 5 21,979,016 (GRCm38) missense probably damaging 0.99
IGL02186:Reln APN 5 21,909,958 (GRCm38) missense probably damaging 1.00
IGL02228:Reln APN 5 21,904,731 (GRCm38) missense probably damaging 0.99
IGL02248:Reln APN 5 21,910,992 (GRCm38) missense probably damaging 1.00
IGL02336:Reln APN 5 21,929,134 (GRCm38) missense probably damaging 1.00
IGL02352:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL02359:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL02376:Reln APN 5 22,080,791 (GRCm38) nonsense probably null
IGL02408:Reln APN 5 21,901,619 (GRCm38) missense probably benign 0.44
IGL02415:Reln APN 5 21,971,951 (GRCm38) missense possibly damaging 0.91
IGL02512:Reln APN 5 22,040,427 (GRCm38) missense probably benign 0.00
IGL02540:Reln APN 5 22,034,752 (GRCm38) missense probably damaging 0.96
IGL02624:Reln APN 5 22,103,357 (GRCm38) missense probably benign 0.09
IGL02720:Reln APN 5 21,997,941 (GRCm38) missense probably damaging 0.99
IGL02894:Reln APN 5 21,885,548 (GRCm38) missense possibly damaging 0.72
IGL02999:Reln APN 5 21,995,365 (GRCm38) missense probably damaging 1.00
IGL03125:Reln APN 5 21,910,844 (GRCm38) missense probably damaging 1.00
IGL03298:Reln APN 5 21,910,836 (GRCm38) missense probably damaging 0.99
Fishing UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
P0020:Reln UTSW 5 22,106,060 (GRCm38) missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22,286,896 (GRCm38) missense possibly damaging 0.71
R0018:Reln UTSW 5 21,925,371 (GRCm38) missense probably benign 0.01
R0105:Reln UTSW 5 22,048,815 (GRCm38) missense probably damaging 0.99
R0105:Reln UTSW 5 22,048,815 (GRCm38) missense probably damaging 0.99
R0127:Reln UTSW 5 22,004,136 (GRCm38) missense probably damaging 1.00
R0135:Reln UTSW 5 22,128,649 (GRCm38) missense probably damaging 0.99
R0144:Reln UTSW 5 21,948,449 (GRCm38) missense probably damaging 0.97
R0240:Reln UTSW 5 22,106,045 (GRCm38) missense probably benign 0.36
R0240:Reln UTSW 5 22,106,045 (GRCm38) missense probably benign 0.36
R0242:Reln UTSW 5 21,942,597 (GRCm38) critical splice donor site probably null
R0242:Reln UTSW 5 21,942,597 (GRCm38) critical splice donor site probably null
R0266:Reln UTSW 5 21,988,776 (GRCm38) missense probably damaging 1.00
R0269:Reln UTSW 5 21,920,537 (GRCm38) missense probably damaging 1.00
R0280:Reln UTSW 5 22,227,513 (GRCm38) splice site probably benign
R0333:Reln UTSW 5 21,929,242 (GRCm38) missense probably damaging 0.97
R0357:Reln UTSW 5 21,950,822 (GRCm38) missense probably damaging 1.00
R0359:Reln UTSW 5 22,048,800 (GRCm38) missense probably damaging 0.98
R0506:Reln UTSW 5 21,920,496 (GRCm38) missense probably damaging 0.97
R0534:Reln UTSW 5 21,947,408 (GRCm38) missense probably damaging 0.99
R0535:Reln UTSW 5 22,051,276 (GRCm38) splice site probably benign
R0541:Reln UTSW 5 21,980,109 (GRCm38) missense possibly damaging 0.88
R0615:Reln UTSW 5 22,010,150 (GRCm38) missense probably benign 0.36
R0617:Reln UTSW 5 21,920,537 (GRCm38) missense probably damaging 1.00
R0634:Reln UTSW 5 22,018,869 (GRCm38) missense probably damaging 1.00
R0653:Reln UTSW 5 21,913,230 (GRCm38) missense probably benign 0.44
R0704:Reln UTSW 5 21,896,811 (GRCm38) missense probably damaging 0.99
R0706:Reln UTSW 5 21,896,811 (GRCm38) missense probably damaging 0.99
R0959:Reln UTSW 5 22,227,628 (GRCm38) missense probably damaging 0.96
R1066:Reln UTSW 5 22,034,664 (GRCm38) missense probably damaging 1.00
R1110:Reln UTSW 5 22,034,775 (GRCm38) missense probably benign
R1163:Reln UTSW 5 21,899,029 (GRCm38) missense probably benign 0.03
R1222:Reln UTSW 5 21,986,955 (GRCm38) missense probably null 0.97
R1226:Reln UTSW 5 21,910,866 (GRCm38) missense probably damaging 1.00
R1440:Reln UTSW 5 22,128,602 (GRCm38) splice site probably benign
R1532:Reln UTSW 5 22,034,744 (GRCm38) missense probably damaging 0.99
R1552:Reln UTSW 5 21,960,378 (GRCm38) missense probably benign 0.01
R1565:Reln UTSW 5 21,925,213 (GRCm38) missense probably benign 0.05
R1618:Reln UTSW 5 22,060,368 (GRCm38) missense probably benign 0.01
R1636:Reln UTSW 5 21,998,683 (GRCm38) missense probably damaging 0.99
R1664:Reln UTSW 5 21,929,086 (GRCm38) missense probably damaging 1.00
R1716:Reln UTSW 5 21,955,095 (GRCm38) missense probably damaging 0.98
R1759:Reln UTSW 5 22,010,289 (GRCm38) missense probably damaging 0.99
R1835:Reln UTSW 5 21,979,002 (GRCm38) missense probably damaging 1.00
R1907:Reln UTSW 5 22,044,962 (GRCm38) critical splice donor site probably null
R1991:Reln UTSW 5 21,969,360 (GRCm38) missense possibly damaging 0.56
R2046:Reln UTSW 5 21,942,627 (GRCm38) missense probably benign 0.01
R2072:Reln UTSW 5 21,919,177 (GRCm38) missense probably damaging 1.00
R2103:Reln UTSW 5 21,969,360 (GRCm38) missense possibly damaging 0.56
R2119:Reln UTSW 5 22,019,000 (GRCm38) missense probably damaging 1.00
R2120:Reln UTSW 5 21,969,085 (GRCm38) missense probably damaging 1.00
R2216:Reln UTSW 5 22,048,005 (GRCm38) missense probably benign 0.30
R2219:Reln UTSW 5 21,972,047 (GRCm38) missense possibly damaging 0.88
R2228:Reln UTSW 5 21,987,078 (GRCm38) missense possibly damaging 0.69
R2306:Reln UTSW 5 21,896,786 (GRCm38) missense probably damaging 1.00
R2316:Reln UTSW 5 22,154,956 (GRCm38) missense probably benign 0.00
R2321:Reln UTSW 5 21,915,020 (GRCm38) missense probably damaging 0.99
R2512:Reln UTSW 5 21,979,690 (GRCm38) missense possibly damaging 0.89
R2519:Reln UTSW 5 22,344,369 (GRCm38) missense unknown
R2870:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2870:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R3195:Reln UTSW 5 22,040,420 (GRCm38) missense possibly damaging 0.72
R3545:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3546:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3547:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3706:Reln UTSW 5 21,995,589 (GRCm38) splice site probably benign
R3713:Reln UTSW 5 21,904,734 (GRCm38) missense probably damaging 0.99
R3770:Reln UTSW 5 21,948,566 (GRCm38) missense probably damaging 1.00
R3836:Reln UTSW 5 21,911,014 (GRCm38) missense probably damaging 1.00
R3887:Reln UTSW 5 21,910,849 (GRCm38) missense possibly damaging 0.92
R3972:Reln UTSW 5 21,979,001 (GRCm38) missense probably damaging 0.99
R3975:Reln UTSW 5 21,995,366 (GRCm38) missense possibly damaging 0.57
R4022:Reln UTSW 5 22,227,630 (GRCm38) missense probably benign 0.45
R4044:Reln UTSW 5 22,128,632 (GRCm38) missense possibly damaging 0.82
R4107:Reln UTSW 5 22,034,584 (GRCm38) missense probably damaging 1.00
R4297:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4298:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4299:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4518:Reln UTSW 5 21,901,743 (GRCm38) missense probably benign 0.44
R4615:Reln UTSW 5 21,972,872 (GRCm38) missense possibly damaging 0.95
R4713:Reln UTSW 5 22,152,463 (GRCm38) missense probably benign 0.17
R4720:Reln UTSW 5 22,286,896 (GRCm38) missense possibly damaging 0.71
R4721:Reln UTSW 5 21,919,222 (GRCm38) missense probably damaging 0.99
R4771:Reln UTSW 5 22,049,700 (GRCm38) missense probably damaging 1.00
R4794:Reln UTSW 5 22,344,185 (GRCm38) missense probably damaging 0.98
R4840:Reln UTSW 5 22,018,846 (GRCm38) splice site probably null
R4860:Reln UTSW 5 21,901,751 (GRCm38) missense probably benign 0.06
R4860:Reln UTSW 5 21,901,751 (GRCm38) missense probably benign 0.06
R4896:Reln UTSW 5 21,955,238 (GRCm38) missense probably damaging 1.00
R4908:Reln UTSW 5 21,979,720 (GRCm38) missense probably benign 0.02
R4912:Reln UTSW 5 21,925,193 (GRCm38) missense probably benign 0.29
R4922:Reln UTSW 5 21,995,587 (GRCm38) critical splice acceptor site probably null
R4975:Reln UTSW 5 21,960,426 (GRCm38) missense probably damaging 1.00
R4976:Reln UTSW 5 21,971,870 (GRCm38) missense probably benign 0.05
R5020:Reln UTSW 5 22,034,638 (GRCm38) missense probably damaging 1.00
R5037:Reln UTSW 5 21,948,512 (GRCm38) missense probably damaging 1.00
R5082:Reln UTSW 5 21,896,077 (GRCm38) missense probably benign 0.00
R5119:Reln UTSW 5 21,971,870 (GRCm38) missense probably benign 0.05
R5125:Reln UTSW 5 21,913,241 (GRCm38) missense possibly damaging 0.78
R5137:Reln UTSW 5 21,955,181 (GRCm38) missense probably damaging 1.00
R5152:Reln UTSW 5 21,948,629 (GRCm38) missense probably damaging 1.00
R5154:Reln UTSW 5 21,988,765 (GRCm38) missense probably damaging 0.99
R5259:Reln UTSW 5 22,103,397 (GRCm38) missense possibly damaging 0.83
R5283:Reln UTSW 5 22,011,163 (GRCm38) missense probably damaging 1.00
R5386:Reln UTSW 5 22,039,529 (GRCm38) missense probably benign
R5400:Reln UTSW 5 21,979,714 (GRCm38) missense probably damaging 1.00
R5478:Reln UTSW 5 22,004,203 (GRCm38) missense probably benign 0.00
R5514:Reln UTSW 5 21,971,885 (GRCm38) missense possibly damaging 0.93
R5529:Reln UTSW 5 21,932,715 (GRCm38) missense possibly damaging 0.71
R5611:Reln UTSW 5 22,039,665 (GRCm38) nonsense probably null
R5648:Reln UTSW 5 21,998,572 (GRCm38) missense probably benign 0.04
R5649:Reln UTSW 5 21,901,625 (GRCm38) missense probably benign 0.33
R5744:Reln UTSW 5 22,106,083 (GRCm38) missense probably null 0.39
R5782:Reln UTSW 5 22,018,056 (GRCm38) missense probably benign 0.01
R5815:Reln UTSW 5 21,947,433 (GRCm38) missense probably damaging 0.99
R5838:Reln UTSW 5 21,899,113 (GRCm38) missense probably damaging 0.97
R6162:Reln UTSW 5 21,911,050 (GRCm38) missense probably damaging 1.00
R6219:Reln UTSW 5 21,948,596 (GRCm38) missense probably damaging 1.00
R6259:Reln UTSW 5 22,060,333 (GRCm38) missense probably damaging 0.99
R6279:Reln UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
R6299:Reln UTSW 5 22,286,944 (GRCm38) missense possibly damaging 0.71
R6300:Reln UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
R6314:Reln UTSW 5 22,152,484 (GRCm38) nonsense probably null
R6351:Reln UTSW 5 21,901,663 (GRCm38) nonsense probably null
R6369:Reln UTSW 5 22,051,361 (GRCm38) missense probably benign 0.03
R6371:Reln UTSW 5 21,995,513 (GRCm38) missense probably benign
R6374:Reln UTSW 5 22,080,714 (GRCm38) missense probably benign 0.06
R6425:Reln UTSW 5 21,911,020 (GRCm38) nonsense probably null
R6442:Reln UTSW 5 21,932,776 (GRCm38) missense probably benign
R6445:Reln UTSW 5 21,919,214 (GRCm38) missense probably benign 0.05
R6554:Reln UTSW 5 21,896,840 (GRCm38) missense probably damaging 1.00
R6641:Reln UTSW 5 21,929,134 (GRCm38) missense probably damaging 1.00
R6768:Reln UTSW 5 21,978,907 (GRCm38) missense probably damaging 0.99
R6859:Reln UTSW 5 22,034,570 (GRCm38) missense probably damaging 1.00
R6896:Reln UTSW 5 21,899,179 (GRCm38) missense probably benign 0.18
R6932:Reln UTSW 5 21,985,857 (GRCm38) missense probably benign 0.00
R6948:Reln UTSW 5 21,972,035 (GRCm38) missense probably damaging 1.00
R6959:Reln UTSW 5 21,976,564 (GRCm38) missense probably damaging 1.00
R7085:Reln UTSW 5 21,915,087 (GRCm38) nonsense probably null
R7091:Reln UTSW 5 21,899,029 (GRCm38) missense probably null 0.08
R7135:Reln UTSW 5 21,976,596 (GRCm38) missense possibly damaging 0.95
R7146:Reln UTSW 5 22,106,097 (GRCm38) missense probably damaging 0.97
R7167:Reln UTSW 5 21,942,620 (GRCm38) missense probably damaging 1.00
R7190:Reln UTSW 5 22,047,947 (GRCm38) missense probably damaging 1.00
R7256:Reln UTSW 5 21,978,923 (GRCm38) missense probably benign 0.03
R7393:Reln UTSW 5 21,976,351 (GRCm38) missense probably damaging 0.99
R7399:Reln UTSW 5 22,051,367 (GRCm38) missense probably damaging 0.99
R7400:Reln UTSW 5 21,971,934 (GRCm38) missense probably damaging 0.99
R7426:Reln UTSW 5 21,971,953 (GRCm38) missense probably damaging 1.00
R7463:Reln UTSW 5 22,103,435 (GRCm38) missense probably damaging 0.98
R7470:Reln UTSW 5 21,942,741 (GRCm38) missense probably damaging 0.99
R7473:Reln UTSW 5 21,929,127 (GRCm38) missense probably benign 0.25
R7501:Reln UTSW 5 22,227,638 (GRCm38) missense possibly damaging 0.91
R7542:Reln UTSW 5 21,955,181 (GRCm38) missense probably damaging 1.00
R7544:Reln UTSW 5 21,976,278 (GRCm38) nonsense probably null
R7588:Reln UTSW 5 21,885,568 (GRCm38) missense probably benign 0.03
R7631:Reln UTSW 5 21,971,935 (GRCm38) missense probably damaging 0.97
R7644:Reln UTSW 5 21,978,931 (GRCm38) missense probably benign 0.39
R7834:Reln UTSW 5 22,039,635 (GRCm38) missense possibly damaging 0.94
R7923:Reln UTSW 5 22,134,692 (GRCm38) missense probably benign 0.00
R7938:Reln UTSW 5 21,950,872 (GRCm38) missense probably damaging 0.97
R8006:Reln UTSW 5 21,899,084 (GRCm38) nonsense probably null
R8062:Reln UTSW 5 21,971,992 (GRCm38) missense probably benign 0.00
R8222:Reln UTSW 5 21,931,477 (GRCm38) nonsense probably null
R8266:Reln UTSW 5 22,018,087 (GRCm38) missense possibly damaging 0.62
R8267:Reln UTSW 5 22,004,112 (GRCm38) missense probably damaging 1.00
R8487:Reln UTSW 5 21,899,029 (GRCm38) missense probably benign 0.03
R8523:Reln UTSW 5 22,004,231 (GRCm38) missense probably damaging 1.00
R8751:Reln UTSW 5 21,942,674 (GRCm38) missense probably benign 0.37
R8801:Reln UTSW 5 21,950,856 (GRCm38) missense possibly damaging 0.94
R8802:Reln UTSW 5 21,925,259 (GRCm38) missense probably damaging 0.98
R8978:Reln UTSW 5 21,885,514 (GRCm38) missense possibly damaging 0.85
R8988:Reln UTSW 5 21,899,157 (GRCm38) missense probably damaging 0.97
R8995:Reln UTSW 5 21,979,579 (GRCm38) missense probably benign 0.00
R9022:Reln UTSW 5 21,976,615 (GRCm38) missense possibly damaging 0.66
R9042:Reln UTSW 5 22,048,038 (GRCm38) missense probably damaging 1.00
R9069:Reln UTSW 5 22,011,061 (GRCm38) missense probably damaging 1.00
R9089:Reln UTSW 5 21,925,200 (GRCm38) missense probably benign 0.01
R9126:Reln UTSW 5 21,955,196 (GRCm38) missense probably damaging 1.00
R9172:Reln UTSW 5 21,950,817 (GRCm38) critical splice donor site probably null
R9182:Reln UTSW 5 21,901,619 (GRCm38) missense probably benign 0.44
R9196:Reln UTSW 5 22,152,473 (GRCm38) missense probably damaging 1.00
R9211:Reln UTSW 5 22,344,202 (GRCm38) nonsense probably null
R9241:Reln UTSW 5 21,969,069 (GRCm38) missense probably damaging 0.99
R9244:Reln UTSW 5 21,915,153 (GRCm38) missense probably damaging 0.99
R9295:Reln UTSW 5 22,004,211 (GRCm38) missense possibly damaging 0.95
R9303:Reln UTSW 5 21,988,707 (GRCm38) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,080,691 (GRCm38) missense probably benign 0.01
R9309:Reln UTSW 5 21,971,868 (GRCm38) missense probably benign 0.37
R9338:Reln UTSW 5 21,997,939 (GRCm38) missense probably damaging 0.98
R9381:Reln UTSW 5 22,344,204 (GRCm38) missense possibly damaging 0.93
R9430:Reln UTSW 5 21,915,107 (GRCm38) missense probably damaging 1.00
R9509:Reln UTSW 5 22,344,200 (GRCm38) missense possibly damaging 0.93
R9515:Reln UTSW 5 21,920,510 (GRCm38) missense possibly damaging 0.46
R9717:Reln UTSW 5 21,931,429 (GRCm38) missense probably benign 0.26
R9745:Reln UTSW 5 21,947,527 (GRCm38) missense probably damaging 1.00
R9778:Reln UTSW 5 21,950,945 (GRCm38) missense probably damaging 1.00
Z1176:Reln UTSW 5 21,979,024 (GRCm38) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,004,082 (GRCm38) missense probably damaging 0.96
Z1177:Reln UTSW 5 21,969,241 (GRCm38) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,227,636 (GRCm38) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,154,959 (GRCm38) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGAGACTGACCTGGTCGATC -3'
(R):5'- TTGGACACTCGTTAAATCGTCGTG -3'

Sequencing Primer
(F):5'- TCGATCACCCAGGGGCTATAG -3'
(R):5'- ATCGTCGTGTTTATTAACATCATCCG -3'
Posted On 2022-03-25