Incidental Mutation 'R0751:Napg'
ID 70365
Institutional Source Beutler Lab
Gene Symbol Napg
Ensembl Gene ENSMUSG00000024581
Gene Name N-ethylmaleimide sensitive fusion protein attachment protein gamma
Synonyms 2400003O04Rik, SNARE
MMRRC Submission 038931-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock # R0751 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 62977836-62999450 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 62994338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 204 (H204Q)
Ref Sequence ENSEMBL: ENSMUSP00000025474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025474] [ENSMUST00000150267]
AlphaFold Q9CWZ7
Predicted Effect probably benign
Transcript: ENSMUST00000025474
AA Change: H204Q

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025474
Gene: ENSMUSG00000024581
AA Change: H204Q

DomainStartEndE-ValueType
Pfam:SNAP 7 261 1e-30 PFAM
low complexity region 294 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124837
Predicted Effect probably benign
Transcript: ENSMUST00000150267
AA Change: H254Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122681
Gene: ENSMUSG00000024581
AA Change: H254Q

DomainStartEndE-ValueType
Pfam:SNAP 7 195 6.7e-23 PFAM
low complexity region 204 214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155440
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes soluble NSF attachment protein gamma. The soluble NSF attachment proteins (SNAPs) enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. The product of this gene mediates platelet exocytosis and controls the membrane fusion events of this process.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alox12 T C 11: 70,246,950 I455V probably benign Het
Ankrd28 A G 14: 31,764,268 L89P probably damaging Het
Aqp9 A T 9: 71,138,205 C41S probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Aspm A T 1: 139,456,898 probably benign Het
Cacfd1 T C 2: 27,018,981 probably null Het
Cd33 T C 7: 43,532,121 D205G probably damaging Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chtf8 A G 8: 106,886,477 probably null Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Clock A T 5: 76,229,361 I696K possibly damaging Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Derl2 T C 11: 71,014,547 probably null Het
Dnah7c A G 1: 46,465,905 T154A probably benign Het
Dnmt3b T A 2: 153,674,842 probably null Het
Dusp3 A T 11: 101,981,728 S106T probably benign Het
Eftud2 A G 11: 102,839,253 V897A probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Fbxo33 A C 12: 59,219,092 F130V probably damaging Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fig4 T C 10: 41,272,982 D158G probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gabra2 A G 5: 71,092,099 probably benign Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Gm9268 A G 7: 43,047,409 Y630C probably damaging Het
Hkdc1 T C 10: 62,398,673 D581G probably damaging Het
Iqgap1 A G 7: 80,725,573 probably benign Het
Larp4b T C 13: 9,166,309 probably benign Het
Lcp1 A T 14: 75,199,387 M58L probably benign Het
Lrrc8a T C 2: 30,256,350 V392A possibly damaging Het
Mavs A T 2: 131,246,764 Y496F probably damaging Het
Mpi A T 9: 57,550,614 S102T probably damaging Het
Mroh9 G A 1: 163,066,124 R161W possibly damaging Het
Myo1h A T 5: 114,320,686 S161C probably damaging Het
Nelfcd C A 2: 174,423,014 A182D probably benign Het
Ntsr2 G T 12: 16,654,030 K91N probably damaging Het
Obscn A G 11: 59,081,819 S2134P probably damaging Het
Ogfod2 G A 5: 124,113,476 probably benign Het
Olfr385 G T 11: 73,589,144 T198K probably benign Het
Olfr525 G A 7: 140,323,325 V209I probably benign Het
Pcdha8 T C 18: 36,994,070 V535A probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pimreg C A 11: 72,043,113 Q22K probably benign Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ppip5k2 A T 1: 97,749,652 C306* probably null Het
Ptprc A G 1: 138,092,930 Y588H probably damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc12a4 A T 8: 105,951,900 V266E probably damaging Het
Slc8b1 A G 5: 120,524,195 probably benign Het
Smim4 G T 14: 31,088,996 probably benign Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Ssb T A 2: 69,870,565 S330T probably benign Het
Stard9 G T 2: 120,697,485 V1408F probably benign Het
Sumf2 A T 5: 129,850,005 T61S probably benign Het
Sypl2 T C 3: 108,216,756 T157A probably damaging Het
Tgfbr3 A T 5: 107,139,883 D483E probably damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Tradd T C 8: 105,259,771 E123G probably damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Ttc30a2 C T 2: 75,978,031 A46T probably damaging Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ubr4 C T 4: 139,437,198 probably benign Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vmn2r63 A C 7: 42,928,035 F360V probably damaging Het
Vmn2r78 G A 7: 86,954,380 V589M possibly damaging Het
Vrk2 A G 11: 26,483,331 probably benign Het
Other mutations in Napg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Napg APN 18 62986445 missense probably benign 0.21
IGL02728:Napg APN 18 62994304 splice site probably benign
IGL02742:Napg APN 18 62986248 missense probably damaging 0.99
R0276:Napg UTSW 18 62986963 missense probably damaging 1.00
R0277:Napg UTSW 18 62986963 missense probably damaging 1.00
R0323:Napg UTSW 18 62986963 missense probably damaging 1.00
R0325:Napg UTSW 18 62986963 missense probably damaging 1.00
R0988:Napg UTSW 18 62983360 splice site probably benign
R1184:Napg UTSW 18 62994338 missense probably benign 0.04
R1387:Napg UTSW 18 62986212 missense possibly damaging 0.50
R1678:Napg UTSW 18 62984072 critical splice donor site probably null
R1779:Napg UTSW 18 62982691 missense probably benign 0.33
R4723:Napg UTSW 18 62992492 critical splice donor site probably null
R5848:Napg UTSW 18 62994369 missense possibly damaging 0.49
R5874:Napg UTSW 18 62978020 nonsense probably null
R5973:Napg UTSW 18 62994983 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAGGCCAGTAACACCAGTGTCAG -3'
(R):5'- TCACACAACCCTGCAATGGTAGTC -3'

Sequencing Primer
(F):5'- CTCCCAGGTGTCCTTTAGAAG -3'
(R):5'- CAATGGTAGTCTTACCTCTTGGAAG -3'
Posted On 2013-09-30