Incidental Mutation 'R9281:Col22a1'
ID 703660
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Name collagen, type XXII, alpha 1
Synonyms C80743, 2310067L16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9281 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 71795795-72034227 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71861071 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1099 (D1099E)
Ref Sequence ENSEMBL: ENSMUSP00000125069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000229585]
AlphaFold E9Q7P1
Predicted Effect unknown
Transcript: ENSMUST00000159993
AA Change: D1099E
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: D1099E

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000229585
AA Change: D544E
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,624,760 I102M possibly damaging Het
2700049A03Rik G A 12: 71,158,913 V444I possibly damaging Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Ano1 A T 7: 144,595,581 Y848N probably damaging Het
Arap2 C T 5: 62,749,505 R57H probably damaging Het
Atp10b C T 11: 43,225,631 T935I probably benign Het
Bcl11b A G 12: 107,915,998 L686P possibly damaging Het
Bmp5 T C 9: 75,776,574 V161A probably benign Het
C1qtnf3 A G 15: 10,978,521 E196G probably benign Het
Cacng8 T A 7: 3,412,092 F130L probably damaging Het
Cap1 A G 4: 122,872,433 M4T probably benign Het
Ccdc57 T C 11: 120,860,587 K886E probably benign Het
Cdhr2 A C 13: 54,733,890 T1112P possibly damaging Het
Clcn4 A T 7: 7,291,814 M316K probably benign Het
Csmd3 A C 15: 47,596,876 N2595K Het
Ctdspl2 A G 2: 122,010,582 H451R probably benign Het
Cybrd1 A T 2: 71,138,391 T203S probably benign Het
Dhx29 A G 13: 112,941,706 N312S possibly damaging Het
Dhx30 A T 9: 110,100,915 S38T probably benign Het
Ercc8 G T 13: 108,183,830 A317S probably benign Het
Fndc3a T C 14: 72,561,657 T629A probably benign Het
Frmpd1 G T 4: 45,284,127 A983S probably benign Het
Gm14325 T A 2: 177,831,804 Y495F probably damaging Het
Gm5773 A T 3: 93,773,584 T188S probably benign Het
Gpsm1 C A 2: 26,324,476 N243K probably damaging Het
Inpp4a C G 1: 37,371,769 H339Q probably damaging Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Kdm4a A G 4: 118,138,531 V1003A probably damaging Het
Lrrc25 T A 8: 70,620,596 M276K probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mcmdc2 G A 1: 9,924,200 G406D probably damaging Het
Mfhas1 G T 8: 35,590,797 A809S probably benign Het
Mier2 A T 10: 79,542,460 D376E probably benign Het
Mllt3 A C 4: 87,789,329 H464Q probably benign Het
Myo6 T A 9: 80,254,882 Y300* probably null Het
Myzap T C 9: 71,586,200 D31G unknown Het
Nfatc1 T C 18: 80,697,975 Y270C probably damaging Het
Nsd3 T C 8: 25,662,945 S434P probably benign Het
Olfr1341 A G 4: 118,709,395 probably benign Het
Olfr385 T A 11: 73,589,307 M144L probably benign Het
Osbp2 T A 11: 3,863,375 T165S probably benign Het
Plxna1 A G 6: 89,323,331 V1590A probably damaging Het
Pramel7 A G 2: 87,491,151 L180P probably damaging Het
Prkd1 C T 12: 50,489,975 D109N probably benign Het
Ptger3 A G 3: 157,567,453 M146V probably benign Het
Pts A G 9: 50,522,553 V96A probably damaging Het
Rab11fip5 T C 6: 85,341,852 E685G probably benign Het
Rab27a C T 9: 73,084,996 T102I probably damaging Het
Reln A G 5: 21,948,547 L2253P probably damaging Het
Rock1 C T 18: 10,080,479 A1022T probably benign Het
Rspry1 T A 8: 94,636,631 N259K probably damaging Het
Sdha A T 13: 74,323,937 Y604* probably null Het
Skiv2l2 A T 13: 112,909,909 C302* probably null Het
Slc12a6 A G 2: 112,334,409 N151S probably benign Het
Slc26a5 T A 5: 21,814,053 D596V probably benign Het
Snrpa A G 7: 27,191,626 V140A probably benign Het
Spta1 T G 1: 174,219,878 V1696G probably damaging Het
St13 A T 15: 81,377,726 D179E probably damaging Het
Stpg4 T C 17: 87,395,243 D182G probably benign Het
Synm A T 7: 67,736,300 L538* probably null Het
Tigar A T 6: 127,091,194 L87H probably damaging Het
Tmem67 C A 4: 12,079,962 V110F possibly damaging Het
Trav6n-5 T A 14: 53,105,287 L94* probably null Het
Ttf1 A G 2: 29,065,890 H422R probably benign Het
Ttn A G 2: 76,789,582 V15914A probably damaging Het
Vmn2r13 C A 5: 109,156,087 C826F probably damaging Het
Wdr60 G A 12: 116,248,057 R277* probably null Het
Wwc1 C G 11: 35,889,384 G248A probably benign Het
Zfp120 G A 2: 150,117,695 H258Y probably damaging Het
Zfp142 A G 1: 74,568,572 Y1681H probably damaging Het
Zkscan3 A G 13: 21,394,875 L150P possibly damaging Het
Zscan4-ps1 G T 7: 11,065,662 F433L possibly damaging Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0083:Col22a1 UTSW 15 71890497 missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1680:Col22a1 UTSW 15 71799361 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71981933 nonsense probably null
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71952339 missense probably benign 0.36
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71801925 missense unknown
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71973836 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 splice site probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
R7179:Col22a1 UTSW 15 71933413 missense unknown
R7215:Col22a1 UTSW 15 71970332 nonsense probably null
R7216:Col22a1 UTSW 15 71973845 missense probably damaging 1.00
R7505:Col22a1 UTSW 15 71799399 nonsense probably null
R7585:Col22a1 UTSW 15 71892205 missense probably damaging 0.99
R7699:Col22a1 UTSW 15 71973851 missense probably damaging 1.00
R7788:Col22a1 UTSW 15 71952317 critical splice donor site probably null
R7921:Col22a1 UTSW 15 71981962 splice site probably null
R8205:Col22a1 UTSW 15 71861069 missense unknown
R8769:Col22a1 UTSW 15 72006722 missense probably benign 0.21
R8780:Col22a1 UTSW 15 72006947 missense probably damaging 0.99
R8827:Col22a1 UTSW 15 71902816 critical splice donor site probably null
R8843:Col22a1 UTSW 15 72006654 missense probably damaging 1.00
R8982:Col22a1 UTSW 15 71973638 critical splice donor site probably null
R9031:Col22a1 UTSW 15 71881674 nonsense probably null
R9036:Col22a1 UTSW 15 71890582 missense probably damaging 1.00
R9084:Col22a1 UTSW 15 71820080 missense unknown
R9386:Col22a1 UTSW 15 71981945 missense probably damaging 1.00
R9406:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R9577:Col22a1 UTSW 15 71965746 missense probably damaging 0.99
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Z1177:Col22a1 UTSW 15 71915120 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAGGCCACACTGGATCTAG -3'
(R):5'- CAGGTGTCTGGCTAGAATTAGAG -3'

Sequencing Primer
(F):5'- CTGGATCTAGACAGTGGAATTTCTTC -3'
(R):5'- ACTGGGTAATGATTATGACTCCTC -3'
Posted On 2022-03-25