Incidental Mutation 'R9282:Aqp3'
ID 703679
Institutional Source Beutler Lab
Gene Symbol Aqp3
Ensembl Gene ENSMUSG00000028435
Gene Name aquaporin 3
Synonyms RP23-28I8.7, AQP-2, OTTMUSP00000006982, GIL, Gill blood group
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 41092722-41098183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41093640 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 258 (V258A)
Ref Sequence ENSEMBL: ENSMUSP00000055110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055327]
AlphaFold Q8R2N1
Predicted Effect possibly damaging
Transcript: ENSMUST00000055327
AA Change: V258A

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055110
Gene: ENSMUSG00000028435
AA Change: V258A

DomainStartEndE-ValueType
Pfam:MIP 16 261 5.9e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the water channel protein aquaporin 3. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein, also known as aquaporin 0. Aquaporin 3 is localized at the basal lateral membranes of collecting duct cells in the kidney. In addition to its water channel function, aquaporin 3 has been found to facilitate the transport of nonionic small solutes such as urea and glycerol, but to a smaller degree. It has been suggested that water channels can be functionally heterogeneous and possess water and solute permeation mechanisms. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Animals homozygous for a mutation in this gene display increased drinking behavior, increased urination, and decreased urine osmolality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp G A 16: 56,620,504 V701M unknown Het
Adam2 G A 14: 66,029,789 P674S probably benign Het
Adam24 T A 8: 40,680,635 Y381N probably damaging Het
Adgrv1 A G 13: 81,103,372 S6209P probably damaging Het
Aox4 A T 1: 58,245,869 K593N possibly damaging Het
Atg16l1 T A 1: 87,780,184 F390I possibly damaging Het
B4galt6 T A 18: 20,692,452 Y239F possibly damaging Het
Cmtr2 T C 8: 110,222,345 M429T probably benign Het
Col5a2 C G 1: 45,438,869 probably null Het
Dcc T C 18: 71,682,178 D375G possibly damaging Het
Dnah14 T C 1: 181,814,512 Y31H Het
Fam131a G A 16: 20,701,493 R232H possibly damaging Het
Fam186a A G 15: 99,941,998 Y2122H probably damaging Het
Focad A T 4: 88,196,822 I421F unknown Het
Fscb T G 12: 64,473,323 E456D possibly damaging Het
Furin C A 7: 80,391,098 S664I probably benign Het
Ganc A G 2: 120,459,900 E906G probably benign Het
Gdf5 C G 2: 155,941,995 D346H probably damaging Het
Golga4 T C 9: 118,556,825 L1005P probably damaging Het
Ifit1bl1 T C 19: 34,594,508 N183S probably benign Het
Itpr1 T A 6: 108,394,023 F1084I probably damaging Het
Katnal1 A T 5: 148,894,211 Y184* probably null Het
Lrrc37a A G 11: 103,500,807 I1264T probably benign Het
Map3k2 T A 18: 32,209,752 M234K probably damaging Het
Mcm3ap T A 10: 76,506,518 V1615E probably damaging Het
Mkrn2 A G 6: 115,614,573 probably null Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nradd T A 9: 110,621,683 Q142L possibly damaging Het
Olfr689 T C 7: 105,314,574 I190T probably benign Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pdzd7 A G 19: 45,040,183 F174L probably damaging Het
Pi4k2b C T 5: 52,743,537 T99I probably benign Het
Pigv A T 4: 133,664,662 V399D probably damaging Het
Pla2g4a C A 1: 149,871,456 L326F probably damaging Het
Psmg1 T C 16: 95,989,517 I73M probably damaging Het
Rcl1 T C 19: 29,115,770 S62P probably damaging Het
Slc23a4 T A 6: 34,978,926 I58F probably damaging Het
Slc36a2 G T 11: 55,170,011 T191K probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tbc1d30 T C 10: 121,306,223 probably null Het
Tbc1d4 A G 14: 101,608,180 V94A possibly damaging Het
Tdrd5 T C 1: 156,277,460 Y532C probably benign Het
Tll2 T A 19: 41,086,333 I931L probably benign Het
Tlr3 T C 8: 45,398,606 N418S probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tshr T A 12: 91,507,744 M164K possibly damaging Het
Ttc21b A G 2: 66,226,005 V679A possibly damaging Het
Ttn A G 2: 76,900,517 Y4951H unknown Het
Usf1 T A 1: 171,415,805 V50D possibly damaging Het
Utp6 A T 11: 79,936,025 M575K probably benign Het
Vmn1r197 A T 13: 22,328,438 R176S possibly damaging Het
Vmn2r104 A T 17: 20,040,836 F442I probably damaging Het
Vmn2r94 A G 17: 18,277,489 F7S possibly damaging Het
Vps41 G T 13: 18,829,231 E340* probably null Het
Other mutations in Aqp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Aqp3 APN 4 41093632 missense probably damaging 1.00
IGL02994:Aqp3 APN 4 41093614 missense probably benign 0.09
phoebus UTSW 4 41095252 missense probably benign 0.05
R0138:Aqp3 UTSW 4 41094843 splice site probably benign
R2097:Aqp3 UTSW 4 41098004 missense possibly damaging 0.95
R2128:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R2129:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R2278:Aqp3 UTSW 4 41093836 missense probably damaging 1.00
R5013:Aqp3 UTSW 4 41093819 missense probably damaging 1.00
R7176:Aqp3 UTSW 4 41095202 missense probably damaging 1.00
R7365:Aqp3 UTSW 4 41098003 missense probably benign 0.14
R7385:Aqp3 UTSW 4 41095178 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCACAAAGGGCTTTCGGGG -3'
(R):5'- ATGGGCTTCAATTCTGGCTATGC -3'

Sequencing Primer
(F):5'- GACTGGTCCCCACACAGTCAG -3'
(R):5'- TGCCCGTGACTTTGGAC -3'
Posted On 2022-03-25