Incidental Mutation 'R9282:Golga4'
ID 703695
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgi autoantigen, golgin subfamily a, 4
Synonyms golgin-245, Olp-1
Accession Numbers

Genbank: NM_018748; MGI: 1859646  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 118506267-118582519 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118556825 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1005 (L1005P)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably damaging
Transcript: ENSMUST00000084820
AA Change: L1005P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: L1005P

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp G A 16: 56,620,504 V701M unknown Het
Adam2 G A 14: 66,029,789 P674S probably benign Het
Adam24 T A 8: 40,680,635 Y381N probably damaging Het
Adgrv1 A G 13: 81,103,372 S6209P probably damaging Het
Aox4 A T 1: 58,245,869 K593N possibly damaging Het
Aqp3 A G 4: 41,093,640 V258A possibly damaging Het
Atg16l1 T A 1: 87,780,184 F390I possibly damaging Het
B4galt6 T A 18: 20,692,452 Y239F possibly damaging Het
Cmtr2 T C 8: 110,222,345 M429T probably benign Het
Col5a2 C G 1: 45,438,869 probably null Het
Dcc T C 18: 71,682,178 D375G possibly damaging Het
Dnah14 T C 1: 181,814,512 Y31H Het
Fam131a G A 16: 20,701,493 R232H possibly damaging Het
Fam186a A G 15: 99,941,998 Y2122H probably damaging Het
Focad A T 4: 88,196,822 I421F unknown Het
Fscb T G 12: 64,473,323 E456D possibly damaging Het
Furin C A 7: 80,391,098 S664I probably benign Het
Ganc A G 2: 120,459,900 E906G probably benign Het
Gdf5 C G 2: 155,941,995 D346H probably damaging Het
Ifit1bl1 T C 19: 34,594,508 N183S probably benign Het
Itpr1 T A 6: 108,394,023 F1084I probably damaging Het
Katnal1 A T 5: 148,894,211 Y184* probably null Het
Lrrc37a A G 11: 103,500,807 I1264T probably benign Het
Map3k2 T A 18: 32,209,752 M234K probably damaging Het
Mcm3ap T A 10: 76,506,518 V1615E probably damaging Het
Mkrn2 A G 6: 115,614,573 probably null Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nradd T A 9: 110,621,683 Q142L possibly damaging Het
Olfr689 T C 7: 105,314,574 I190T probably benign Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pdzd7 A G 19: 45,040,183 F174L probably damaging Het
Pi4k2b C T 5: 52,743,537 T99I probably benign Het
Pigv A T 4: 133,664,662 V399D probably damaging Het
Pla2g4a C A 1: 149,871,456 L326F probably damaging Het
Psmg1 T C 16: 95,989,517 I73M probably damaging Het
Rcl1 T C 19: 29,115,770 S62P probably damaging Het
Slc23a4 T A 6: 34,978,926 I58F probably damaging Het
Slc36a2 G T 11: 55,170,011 T191K probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tbc1d30 T C 10: 121,306,223 probably null Het
Tbc1d4 A G 14: 101,608,180 V94A possibly damaging Het
Tdrd5 T C 1: 156,277,460 Y532C probably benign Het
Tll2 T A 19: 41,086,333 I931L probably benign Het
Tlr3 T C 8: 45,398,606 N418S probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tshr T A 12: 91,507,744 M164K possibly damaging Het
Ttc21b A G 2: 66,226,005 V679A possibly damaging Het
Ttn A G 2: 76,900,517 Y4951H unknown Het
Usf1 T A 1: 171,415,805 V50D possibly damaging Het
Utp6 A T 11: 79,936,025 M575K probably benign Het
Vmn1r197 A T 13: 22,328,438 R176S possibly damaging Het
Vmn2r104 A T 17: 20,040,836 F442I probably damaging Het
Vmn2r94 A G 17: 18,277,489 F7S possibly damaging Het
Vps41 G T 13: 18,829,231 E340* probably null Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118514271 critical splice donor site probably null
IGL00801:Golga4 APN 9 118538926 missense probably damaging 0.98
IGL01395:Golga4 APN 9 118535373 missense probably damaging 1.00
IGL01472:Golga4 APN 9 118532574 missense probably damaging 1.00
IGL01519:Golga4 APN 9 118527092 missense probably damaging 1.00
IGL01563:Golga4 APN 9 118527006 splice site probably benign
IGL02593:Golga4 APN 9 118555566 unclassified probably benign
IGL02803:Golga4 APN 9 118535460 missense probably benign
IGL02939:Golga4 APN 9 118535454 missense probably benign 0.01
IGL02939:Golga4 APN 9 118534632 missense probably damaging 1.00
IGL03123:Golga4 APN 9 118536885 missense probably damaging 1.00
IGL03334:Golga4 APN 9 118537233 splice site probably benign
F5770:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118553457 missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118553453 missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118560740 critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118568993 missense probably benign 0.00
R0362:Golga4 UTSW 9 118555785 missense probably benign 0.13
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0974:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R1128:Golga4 UTSW 9 118548784 missense probably benign 0.40
R1384:Golga4 UTSW 9 118565651 missense probably damaging 0.99
R1435:Golga4 UTSW 9 118535440 missense probably benign 0.00
R1513:Golga4 UTSW 9 118555732 missense probably benign 0.02
R1818:Golga4 UTSW 9 118572987 missense probably damaging 1.00
R2083:Golga4 UTSW 9 118532590 missense probably damaging 1.00
R2243:Golga4 UTSW 9 118556904 missense probably benign 0.06
R2355:Golga4 UTSW 9 118560742 missense probably benign 0.00
R2518:Golga4 UTSW 9 118556612 missense probably damaging 1.00
R2921:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118557380 missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118534647 missense probably benign 0.16
R3909:Golga4 UTSW 9 118558736 missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118538971 missense probably damaging 0.99
R4321:Golga4 UTSW 9 118556435 missense probably damaging 1.00
R4358:Golga4 UTSW 9 118551878 missense probably benign 0.16
R4483:Golga4 UTSW 9 118514186 missense probably damaging 1.00
R4515:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4518:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4519:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4545:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4546:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4580:Golga4 UTSW 9 118557259 missense probably benign 0.00
R4918:Golga4 UTSW 9 118558145 missense probably damaging 1.00
R5007:Golga4 UTSW 9 118558300 missense probably benign
R5045:Golga4 UTSW 9 118565656 missense probably benign
R5232:Golga4 UTSW 9 118506558 critical splice donor site probably null
R5256:Golga4 UTSW 9 118556501 missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118559057 nonsense probably null
R5567:Golga4 UTSW 9 118558183 missense probably damaging 1.00
R5576:Golga4 UTSW 9 118553534 missense probably benign 0.13
R5771:Golga4 UTSW 9 118558283 missense probably damaging 0.96
R5807:Golga4 UTSW 9 118527130 missense probably damaging 0.99
R5860:Golga4 UTSW 9 118558106 missense probably damaging 1.00
R6012:Golga4 UTSW 9 118559696 missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118558627 nonsense probably null
R6299:Golga4 UTSW 9 118557370 missense probably benign 0.03
R6467:Golga4 UTSW 9 118536792 missense probably damaging 1.00
R6552:Golga4 UTSW 9 118514231 missense probably damaging 1.00
R6688:Golga4 UTSW 9 118514210 missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118548779 missense probably damaging 1.00
R6987:Golga4 UTSW 9 118558532 missense probably benign
R7212:Golga4 UTSW 9 118536840 missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118559495 missense probably benign
R7431:Golga4 UTSW 9 118559731 missense probably damaging 1.00
R7641:Golga4 UTSW 9 118557575 missense probably benign 0.05
R7727:Golga4 UTSW 9 118548702 missense probably damaging 1.00
R7729:Golga4 UTSW 9 118556063 missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118532575 missense probably damaging 1.00
R7849:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118556366 missense probably damaging 1.00
R7976:Golga4 UTSW 9 118536768 missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118532559 missense probably damaging 1.00
R8378:Golga4 UTSW 9 118558322 missense probably benign 0.03
R8514:Golga4 UTSW 9 118555796 missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118555961 missense probably damaging 0.97
R8856:Golga4 UTSW 9 118556711 missense probably damaging 0.98
R9227:Golga4 UTSW 9 118556873 missense possibly damaging 0.94
RF022:Golga4 UTSW 9 118557989 missense probably damaging 1.00
V7583:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCTTACAGATGCGAGAGGAGC -3'
(R):5'- CCAGGCCTCTATGACATCATC -3'

Sequencing Primer
(F):5'- GAGATCCTCAAACAGACATTGTCTTC -3'
(R):5'- ATCAAGTTTTCGCTGATGAGCC -3'
Posted On 2022-03-25