Incidental Mutation 'R9282:Slc36a2'
ID 703698
Institutional Source Beutler Lab
Gene Symbol Slc36a2
Ensembl Gene ENSMUSG00000020264
Gene Name solute carrier family 36 (proton/amino acid symporter), member 2
Synonyms PAT2, Tramd1, A530067G19Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.363) question?
Stock # R9282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 55049296-55075903 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 55060837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 191 (T191K)
Ref Sequence ENSEMBL: ENSMUSP00000045613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039305]
AlphaFold Q8BHK3
Predicted Effect probably benign
Transcript: ENSMUST00000039305
AA Change: T191K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000045613
Gene: ENSMUSG00000020264
AA Change: T191K

DomainStartEndE-ValueType
Pfam:Aa_trans 47 458 3.6e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pH-dependent proton-coupled amino acid transporter that belongs to the amino acid auxin permease 1 protein family. The encoded protein primarily transports small amino acids such as glycine, alanine and proline. Mutations in this gene are associated with iminoglycinuria and hyperglycinuria. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp G A 16: 56,440,867 (GRCm39) V701M unknown Het
Adam2 G A 14: 66,267,238 (GRCm39) P674S probably benign Het
Adam24 T A 8: 41,133,674 (GRCm39) Y381N probably damaging Het
Adgrv1 A G 13: 81,251,491 (GRCm39) S6209P probably damaging Het
Aox4 A T 1: 58,285,028 (GRCm39) K593N possibly damaging Het
Aqp3 A G 4: 41,093,640 (GRCm39) V258A possibly damaging Het
Atg16l1 T A 1: 87,707,906 (GRCm39) F390I possibly damaging Het
B4galt6 T A 18: 20,825,509 (GRCm39) Y239F possibly damaging Het
Cmtr2 T C 8: 110,948,977 (GRCm39) M429T probably benign Het
Col5a2 C G 1: 45,478,029 (GRCm39) probably null Het
Dcc T C 18: 71,815,249 (GRCm39) D375G possibly damaging Het
Dnah14 T C 1: 181,642,077 (GRCm39) Y31H Het
Fam131a G A 16: 20,520,243 (GRCm39) R232H possibly damaging Het
Fam186a A G 15: 99,839,879 (GRCm39) Y2122H probably damaging Het
Focad A T 4: 88,115,059 (GRCm39) I421F unknown Het
Fscb T G 12: 64,520,097 (GRCm39) E456D possibly damaging Het
Furin C A 7: 80,040,846 (GRCm39) S664I probably benign Het
Ganc A G 2: 120,290,381 (GRCm39) E906G probably benign Het
Gdf5 C G 2: 155,783,915 (GRCm39) D346H probably damaging Het
Golga4 T C 9: 118,385,893 (GRCm39) L1005P probably damaging Het
Ifit1bl1 T C 19: 34,571,908 (GRCm39) N183S probably benign Het
Itpr1 T A 6: 108,370,984 (GRCm39) F1084I probably damaging Het
Katnal1 A T 5: 148,831,021 (GRCm39) Y184* probably null Het
Lrrc37a A G 11: 103,391,633 (GRCm39) I1264T probably benign Het
Map3k2 T A 18: 32,342,805 (GRCm39) M234K probably damaging Het
Mcm3ap T A 10: 76,342,352 (GRCm39) V1615E probably damaging Het
Mkrn2 A G 6: 115,591,534 (GRCm39) probably null Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nradd T A 9: 110,450,751 (GRCm39) Q142L possibly damaging Het
Ophn1 G A X: 97,622,145 (GRCm39) T668M probably benign Het
Or56b35 T C 7: 104,963,781 (GRCm39) I190T probably benign Het
Pdzd7 A G 19: 45,028,622 (GRCm39) F174L probably damaging Het
Pi4k2b C T 5: 52,900,879 (GRCm39) T99I probably benign Het
Pigv A T 4: 133,391,973 (GRCm39) V399D probably damaging Het
Pla2g4a C A 1: 149,747,207 (GRCm39) L326F probably damaging Het
Psmg1 T C 16: 95,790,717 (GRCm39) I73M probably damaging Het
Rcl1 T C 19: 29,093,170 (GRCm39) S62P probably damaging Het
Slc23a4 T A 6: 34,955,861 (GRCm39) I58F probably damaging Het
Sorbs2 T G 8: 46,248,774 (GRCm39) V675G probably benign Het
Tbc1d30 T C 10: 121,142,128 (GRCm39) probably null Het
Tbc1d4 A G 14: 101,845,616 (GRCm39) V94A possibly damaging Het
Tdrd5 T C 1: 156,105,030 (GRCm39) Y532C probably benign Het
Tll2 T A 19: 41,074,772 (GRCm39) I931L probably benign Het
Tlr3 T C 8: 45,851,643 (GRCm39) N418S probably benign Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tshr T A 12: 91,474,518 (GRCm39) M164K possibly damaging Het
Ttc21b A G 2: 66,056,349 (GRCm39) V679A possibly damaging Het
Ttn A G 2: 76,730,861 (GRCm39) Y4951H unknown Het
Usf1 T A 1: 171,243,373 (GRCm39) V50D possibly damaging Het
Utp6 A T 11: 79,826,851 (GRCm39) M575K probably benign Het
Vmn1r197 A T 13: 22,512,608 (GRCm39) R176S possibly damaging Het
Vmn2r104 A T 17: 20,261,098 (GRCm39) F442I probably damaging Het
Vmn2r94 A G 17: 18,497,751 (GRCm39) F7S possibly damaging Het
Vps41 G T 13: 19,013,401 (GRCm39) E340* probably null Het
Other mutations in Slc36a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Slc36a2 APN 11 55,053,614 (GRCm39) nonsense probably null
IGL01152:Slc36a2 APN 11 55,060,673 (GRCm39) splice site probably benign
IGL01545:Slc36a2 APN 11 55,075,633 (GRCm39) splice site probably null
IGL01835:Slc36a2 APN 11 55,053,559 (GRCm39) missense probably benign 0.01
IGL02935:Slc36a2 APN 11 55,060,854 (GRCm39) missense possibly damaging 0.67
R0025:Slc36a2 UTSW 11 55,053,621 (GRCm39) missense probably damaging 1.00
R0025:Slc36a2 UTSW 11 55,053,621 (GRCm39) missense probably damaging 1.00
R0067:Slc36a2 UTSW 11 55,053,466 (GRCm39) splice site probably benign
R0417:Slc36a2 UTSW 11 55,072,370 (GRCm39) critical splice donor site probably null
R0747:Slc36a2 UTSW 11 55,060,685 (GRCm39) missense probably benign 0.00
R0927:Slc36a2 UTSW 11 55,072,411 (GRCm39) missense probably damaging 0.98
R1186:Slc36a2 UTSW 11 55,055,057 (GRCm39) critical splice donor site probably null
R1673:Slc36a2 UTSW 11 55,075,739 (GRCm39) missense possibly damaging 0.86
R1677:Slc36a2 UTSW 11 55,075,735 (GRCm39) missense probably benign
R2109:Slc36a2 UTSW 11 55,072,381 (GRCm39) missense probably damaging 1.00
R4037:Slc36a2 UTSW 11 55,055,101 (GRCm39) missense probably benign 0.10
R4945:Slc36a2 UTSW 11 55,065,520 (GRCm39) missense probably benign 0.10
R5108:Slc36a2 UTSW 11 55,050,214 (GRCm39) missense probably damaging 0.96
R6534:Slc36a2 UTSW 11 55,075,693 (GRCm39) missense probably benign 0.00
R7188:Slc36a2 UTSW 11 55,053,483 (GRCm39) missense possibly damaging 0.95
R7219:Slc36a2 UTSW 11 55,059,744 (GRCm39) missense probably benign 0.14
R7564:Slc36a2 UTSW 11 55,053,498 (GRCm39) missense probably benign 0.00
R8017:Slc36a2 UTSW 11 55,055,095 (GRCm39) missense probably benign 0.01
R8019:Slc36a2 UTSW 11 55,055,095 (GRCm39) missense probably benign 0.01
R8310:Slc36a2 UTSW 11 55,070,158 (GRCm39) missense possibly damaging 0.69
R9334:Slc36a2 UTSW 11 55,075,865 (GRCm39) start gained probably benign
R9711:Slc36a2 UTSW 11 55,070,169 (GRCm39) missense probably benign
X0063:Slc36a2 UTSW 11 55,059,654 (GRCm39) critical splice donor site probably null
Z1176:Slc36a2 UTSW 11 55,070,228 (GRCm39) missense probably benign 0.00
Z1177:Slc36a2 UTSW 11 55,060,880 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTATTATTGATACAAGGGTCCTGTGTC -3'
(R):5'- AGTACCCTGTACTTGCTCGAG -3'

Sequencing Primer
(F):5'- CCTGTGTCCTGGGGAGTCAG -3'
(R):5'- GAGCTCCCCCGACTCTTTGTAAG -3'
Posted On 2022-03-25