Incidental Mutation 'R9282:Slc36a2'
ID 703698
Institutional Source Beutler Lab
Gene Symbol Slc36a2
Ensembl Gene ENSMUSG00000020264
Gene Name solute carrier family 36 (proton/amino acid symporter), member 2
Synonyms PAT2, A530067G19Rik, Tramd1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R9282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 55158470-55185077 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 55170011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 191 (T191K)
Ref Sequence ENSEMBL: ENSMUSP00000045613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039305]
AlphaFold Q8BHK3
Predicted Effect probably benign
Transcript: ENSMUST00000039305
AA Change: T191K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000045613
Gene: ENSMUSG00000020264
AA Change: T191K

DomainStartEndE-ValueType
Pfam:Aa_trans 47 458 3.6e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pH-dependent proton-coupled amino acid transporter that belongs to the amino acid auxin permease 1 protein family. The encoded protein primarily transports small amino acids such as glycine, alanine and proline. Mutations in this gene are associated with iminoglycinuria and hyperglycinuria. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp G A 16: 56,620,504 V701M unknown Het
Adam2 G A 14: 66,029,789 P674S probably benign Het
Adam24 T A 8: 40,680,635 Y381N probably damaging Het
Adgrv1 A G 13: 81,103,372 S6209P probably damaging Het
Aox4 A T 1: 58,245,869 K593N possibly damaging Het
Aqp3 A G 4: 41,093,640 V258A possibly damaging Het
Atg16l1 T A 1: 87,780,184 F390I possibly damaging Het
B4galt6 T A 18: 20,692,452 Y239F possibly damaging Het
Cmtr2 T C 8: 110,222,345 M429T probably benign Het
Col5a2 C G 1: 45,438,869 probably null Het
Dcc T C 18: 71,682,178 D375G possibly damaging Het
Dnah14 T C 1: 181,814,512 Y31H Het
Fam131a G A 16: 20,701,493 R232H possibly damaging Het
Fam186a A G 15: 99,941,998 Y2122H probably damaging Het
Focad A T 4: 88,196,822 I421F unknown Het
Fscb T G 12: 64,473,323 E456D possibly damaging Het
Furin C A 7: 80,391,098 S664I probably benign Het
Ganc A G 2: 120,459,900 E906G probably benign Het
Gdf5 C G 2: 155,941,995 D346H probably damaging Het
Golga4 T C 9: 118,556,825 L1005P probably damaging Het
Ifit1bl1 T C 19: 34,594,508 N183S probably benign Het
Itpr1 T A 6: 108,394,023 F1084I probably damaging Het
Katnal1 A T 5: 148,894,211 Y184* probably null Het
Lrrc37a A G 11: 103,500,807 I1264T probably benign Het
Map3k2 T A 18: 32,209,752 M234K probably damaging Het
Mcm3ap T A 10: 76,506,518 V1615E probably damaging Het
Mkrn2 A G 6: 115,614,573 probably null Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nradd T A 9: 110,621,683 Q142L possibly damaging Het
Olfr689 T C 7: 105,314,574 I190T probably benign Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pdzd7 A G 19: 45,040,183 F174L probably damaging Het
Pi4k2b C T 5: 52,743,537 T99I probably benign Het
Pigv A T 4: 133,664,662 V399D probably damaging Het
Pla2g4a C A 1: 149,871,456 L326F probably damaging Het
Psmg1 T C 16: 95,989,517 I73M probably damaging Het
Rcl1 T C 19: 29,115,770 S62P probably damaging Het
Slc23a4 T A 6: 34,978,926 I58F probably damaging Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tbc1d30 T C 10: 121,306,223 probably null Het
Tbc1d4 A G 14: 101,608,180 V94A possibly damaging Het
Tdrd5 T C 1: 156,277,460 Y532C probably benign Het
Tll2 T A 19: 41,086,333 I931L probably benign Het
Tlr3 T C 8: 45,398,606 N418S probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tshr T A 12: 91,507,744 M164K possibly damaging Het
Ttc21b A G 2: 66,226,005 V679A possibly damaging Het
Ttn A G 2: 76,900,517 Y4951H unknown Het
Usf1 T A 1: 171,415,805 V50D possibly damaging Het
Utp6 A T 11: 79,936,025 M575K probably benign Het
Vmn1r197 A T 13: 22,328,438 R176S possibly damaging Het
Vmn2r104 A T 17: 20,040,836 F442I probably damaging Het
Vmn2r94 A G 17: 18,277,489 F7S possibly damaging Het
Vps41 G T 13: 18,829,231 E340* probably null Het
Other mutations in Slc36a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Slc36a2 APN 11 55162788 nonsense probably null
IGL01152:Slc36a2 APN 11 55169847 splice site probably benign
IGL01545:Slc36a2 APN 11 55184807 splice site probably null
IGL01835:Slc36a2 APN 11 55162733 missense probably benign 0.01
IGL02935:Slc36a2 APN 11 55170028 missense possibly damaging 0.67
R0025:Slc36a2 UTSW 11 55162795 missense probably damaging 1.00
R0025:Slc36a2 UTSW 11 55162795 missense probably damaging 1.00
R0067:Slc36a2 UTSW 11 55162640 splice site probably benign
R0417:Slc36a2 UTSW 11 55181544 critical splice donor site probably null
R0747:Slc36a2 UTSW 11 55169859 missense probably benign 0.00
R0927:Slc36a2 UTSW 11 55181585 missense probably damaging 0.98
R1186:Slc36a2 UTSW 11 55164231 critical splice donor site probably null
R1673:Slc36a2 UTSW 11 55184913 missense possibly damaging 0.86
R1677:Slc36a2 UTSW 11 55184909 missense probably benign
R2109:Slc36a2 UTSW 11 55181555 missense probably damaging 1.00
R4037:Slc36a2 UTSW 11 55164275 missense probably benign 0.10
R4945:Slc36a2 UTSW 11 55174694 missense probably benign 0.10
R5108:Slc36a2 UTSW 11 55159388 missense probably damaging 0.96
R6534:Slc36a2 UTSW 11 55184867 missense probably benign 0.00
R7188:Slc36a2 UTSW 11 55162657 missense possibly damaging 0.95
R7219:Slc36a2 UTSW 11 55168918 missense probably benign 0.14
R7564:Slc36a2 UTSW 11 55162672 missense probably benign 0.00
R8017:Slc36a2 UTSW 11 55164269 missense probably benign 0.01
R8019:Slc36a2 UTSW 11 55164269 missense probably benign 0.01
R8310:Slc36a2 UTSW 11 55179332 missense possibly damaging 0.69
R9334:Slc36a2 UTSW 11 55185039 start gained probably benign
X0063:Slc36a2 UTSW 11 55168828 critical splice donor site probably null
Z1176:Slc36a2 UTSW 11 55179402 missense probably benign 0.00
Z1177:Slc36a2 UTSW 11 55170054 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTATTATTGATACAAGGGTCCTGTGTC -3'
(R):5'- AGTACCCTGTACTTGCTCGAG -3'

Sequencing Primer
(F):5'- CCTGTGTCCTGGGGAGTCAG -3'
(R):5'- GAGCTCCCCCGACTCTTTGTAAG -3'
Posted On 2022-03-25