Incidental Mutation 'R9282:Adam2'
ID 703706
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Name a disintegrin and metallopeptidase domain 2
Synonyms fertilin beta, Ftnb, Ph30-beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 66027329-66077733 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 66029789 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 674 (P674S)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
AlphaFold Q60718
Predicted Effect probably benign
Transcript: ENSMUST00000022618
AA Change: P674S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: P674S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp G A 16: 56,620,504 V701M unknown Het
Adam24 T A 8: 40,680,635 Y381N probably damaging Het
Adgrv1 A G 13: 81,103,372 S6209P probably damaging Het
Aox4 A T 1: 58,245,869 K593N possibly damaging Het
Aqp3 A G 4: 41,093,640 V258A possibly damaging Het
Atg16l1 T A 1: 87,780,184 F390I possibly damaging Het
B4galt6 T A 18: 20,692,452 Y239F possibly damaging Het
Cmtr2 T C 8: 110,222,345 M429T probably benign Het
Col5a2 C G 1: 45,438,869 probably null Het
Dcc T C 18: 71,682,178 D375G possibly damaging Het
Dnah14 T C 1: 181,814,512 Y31H Het
Fam131a G A 16: 20,701,493 R232H possibly damaging Het
Fam186a A G 15: 99,941,998 Y2122H probably damaging Het
Focad A T 4: 88,196,822 I421F unknown Het
Fscb T G 12: 64,473,323 E456D possibly damaging Het
Furin C A 7: 80,391,098 S664I probably benign Het
Ganc A G 2: 120,459,900 E906G probably benign Het
Gdf5 C G 2: 155,941,995 D346H probably damaging Het
Golga4 T C 9: 118,556,825 L1005P probably damaging Het
Ifit1bl1 T C 19: 34,594,508 N183S probably benign Het
Itpr1 T A 6: 108,394,023 F1084I probably damaging Het
Katnal1 A T 5: 148,894,211 Y184* probably null Het
Lrrc37a A G 11: 103,500,807 I1264T probably benign Het
Map3k2 T A 18: 32,209,752 M234K probably damaging Het
Mcm3ap T A 10: 76,506,518 V1615E probably damaging Het
Mkrn2 A G 6: 115,614,573 probably null Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nradd T A 9: 110,621,683 Q142L possibly damaging Het
Olfr689 T C 7: 105,314,574 I190T probably benign Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pdzd7 A G 19: 45,040,183 F174L probably damaging Het
Pi4k2b C T 5: 52,743,537 T99I probably benign Het
Pigv A T 4: 133,664,662 V399D probably damaging Het
Pla2g4a C A 1: 149,871,456 L326F probably damaging Het
Psmg1 T C 16: 95,989,517 I73M probably damaging Het
Rcl1 T C 19: 29,115,770 S62P probably damaging Het
Slc23a4 T A 6: 34,978,926 I58F probably damaging Het
Slc36a2 G T 11: 55,170,011 T191K probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tbc1d30 T C 10: 121,306,223 probably null Het
Tbc1d4 A G 14: 101,608,180 V94A possibly damaging Het
Tdrd5 T C 1: 156,277,460 Y532C probably benign Het
Tll2 T A 19: 41,086,333 I931L probably benign Het
Tlr3 T C 8: 45,398,606 N418S probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tshr T A 12: 91,507,744 M164K possibly damaging Het
Ttc21b A G 2: 66,226,005 V679A possibly damaging Het
Ttn A G 2: 76,900,517 Y4951H unknown Het
Usf1 T A 1: 171,415,805 V50D possibly damaging Het
Utp6 A T 11: 79,936,025 M575K probably benign Het
Vmn1r197 A T 13: 22,328,438 R176S possibly damaging Het
Vmn2r104 A T 17: 20,040,836 F442I probably damaging Het
Vmn2r94 A G 17: 18,277,489 F7S possibly damaging Het
Vps41 G T 13: 18,829,231 E340* probably null Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66074049 critical splice donor site probably null
IGL00980:Adam2 APN 14 66056528 nonsense probably null
IGL01404:Adam2 APN 14 66077210 critical splice donor site probably null
IGL01901:Adam2 APN 14 66035229 splice site probably benign
IGL02687:Adam2 APN 14 66069190 missense probably damaging 1.00
IGL02692:Adam2 APN 14 66074087 missense probably damaging 1.00
IGL02695:Adam2 APN 14 66050480 missense probably benign 0.01
IGL02798:Adam2 APN 14 66040275 missense probably damaging 1.00
IGL03217:Adam2 APN 14 66034813 missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66053831 missense probably benign 0.03
aldrin UTSW 14 66057637 missense probably damaging 1.00
armstrong UTSW 14 66037557 missense possibly damaging 0.95
sacher UTSW 14 66068558 missense probably damaging 1.00
zuker UTSW 14 66059912 missense probably benign 0.14
R0092:Adam2 UTSW 14 66053887 missense probably damaging 1.00
R0281:Adam2 UTSW 14 66037606 missense probably benign 0.20
R0636:Adam2 UTSW 14 66034816 missense probably benign 0.03
R0690:Adam2 UTSW 14 66057646 missense probably damaging 1.00
R0727:Adam2 UTSW 14 66029731 missense probably damaging 1.00
R1477:Adam2 UTSW 14 66077700 missense possibly damaging 0.96
R1634:Adam2 UTSW 14 66057731 missense probably damaging 1.00
R1652:Adam2 UTSW 14 66077251 missense probably benign 0.41
R1717:Adam2 UTSW 14 66068558 missense probably damaging 1.00
R1868:Adam2 UTSW 14 66077658 missense probably damaging 0.99
R1915:Adam2 UTSW 14 66037557 missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66059912 missense probably benign 0.14
R3953:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3954:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3955:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3956:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3957:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R4091:Adam2 UTSW 14 66029723 missense probably damaging 0.97
R5673:Adam2 UTSW 14 66069232 missense probably benign 0.03
R5761:Adam2 UTSW 14 66046146 missense probably damaging 1.00
R6187:Adam2 UTSW 14 66068619 missense possibly damaging 0.89
R6499:Adam2 UTSW 14 66058790 missense probably damaging 1.00
R6730:Adam2 UTSW 14 66037576 missense possibly damaging 0.83
R6829:Adam2 UTSW 14 66027997 critical splice donor site probably null
R7023:Adam2 UTSW 14 66043056 missense probably benign 0.22
R7168:Adam2 UTSW 14 66058792 missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66053912 nonsense probably null
R7293:Adam2 UTSW 14 66035185 missense probably benign 0.29
R7604:Adam2 UTSW 14 66056541 missense probably benign 0.17
R7765:Adam2 UTSW 14 66059896 missense probably damaging 1.00
R8380:Adam2 UTSW 14 66037557 missense probably benign 0.01
R8532:Adam2 UTSW 14 66056521 missense probably damaging 1.00
R8728:Adam2 UTSW 14 66057637 missense probably damaging 1.00
R8744:Adam2 UTSW 14 66034716 critical splice donor site probably null
R9307:Adam2 UTSW 14 66050472 missense probably damaging 1.00
R9560:Adam2 UTSW 14 66037653 missense probably benign 0.12
R9574:Adam2 UTSW 14 66037622 missense probably benign 0.10
X0061:Adam2 UTSW 14 66053905 missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66056521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGTCCACGCACTCTTCG -3'
(R):5'- GACTACCTAGAATAGAAGTCTCCAATG -3'

Sequencing Primer
(F):5'- ACGCACTCTTCGCTTGAGAAG -3'
(R):5'- GGGATCCTCATACAGACATGCTTG -3'
Posted On 2022-03-25