Incidental Mutation 'R9282:Vmn2r104'
ID 703713
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Name vomeronasal 2, receptor 104
Synonyms V2r7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R9282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20029425-20048205 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20040836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 442 (F442I)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
AlphaFold E9Q2J5
Predicted Effect probably damaging
Transcript: ENSMUST00000168050
AA Change: F442I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: F442I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp G A 16: 56,620,504 V701M unknown Het
Adam2 G A 14: 66,029,789 P674S probably benign Het
Adam24 T A 8: 40,680,635 Y381N probably damaging Het
Adgrv1 A G 13: 81,103,372 S6209P probably damaging Het
Aox4 A T 1: 58,245,869 K593N possibly damaging Het
Aqp3 A G 4: 41,093,640 V258A possibly damaging Het
Atg16l1 T A 1: 87,780,184 F390I possibly damaging Het
B4galt6 T A 18: 20,692,452 Y239F possibly damaging Het
Cmtr2 T C 8: 110,222,345 M429T probably benign Het
Col5a2 C G 1: 45,438,869 probably null Het
Dcc T C 18: 71,682,178 D375G possibly damaging Het
Dnah14 T C 1: 181,814,512 Y31H Het
Fam131a G A 16: 20,701,493 R232H possibly damaging Het
Fam186a A G 15: 99,941,998 Y2122H probably damaging Het
Focad A T 4: 88,196,822 I421F unknown Het
Fscb T G 12: 64,473,323 E456D possibly damaging Het
Furin C A 7: 80,391,098 S664I probably benign Het
Ganc A G 2: 120,459,900 E906G probably benign Het
Gdf5 C G 2: 155,941,995 D346H probably damaging Het
Golga4 T C 9: 118,556,825 L1005P probably damaging Het
Ifit1bl1 T C 19: 34,594,508 N183S probably benign Het
Itpr1 T A 6: 108,394,023 F1084I probably damaging Het
Katnal1 A T 5: 148,894,211 Y184* probably null Het
Lrrc37a A G 11: 103,500,807 I1264T probably benign Het
Map3k2 T A 18: 32,209,752 M234K probably damaging Het
Mcm3ap T A 10: 76,506,518 V1615E probably damaging Het
Mkrn2 A G 6: 115,614,573 probably null Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nradd T A 9: 110,621,683 Q142L possibly damaging Het
Olfr689 T C 7: 105,314,574 I190T probably benign Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pdzd7 A G 19: 45,040,183 F174L probably damaging Het
Pi4k2b C T 5: 52,743,537 T99I probably benign Het
Pigv A T 4: 133,664,662 V399D probably damaging Het
Pla2g4a C A 1: 149,871,456 L326F probably damaging Het
Psmg1 T C 16: 95,989,517 I73M probably damaging Het
Rcl1 T C 19: 29,115,770 S62P probably damaging Het
Slc23a4 T A 6: 34,978,926 I58F probably damaging Het
Slc36a2 G T 11: 55,170,011 T191K probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tbc1d30 T C 10: 121,306,223 probably null Het
Tbc1d4 A G 14: 101,608,180 V94A possibly damaging Het
Tdrd5 T C 1: 156,277,460 Y532C probably benign Het
Tll2 T A 19: 41,086,333 I931L probably benign Het
Tlr3 T C 8: 45,398,606 N418S probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tshr T A 12: 91,507,744 M164K possibly damaging Het
Ttc21b A G 2: 66,226,005 V679A possibly damaging Het
Ttn A G 2: 76,900,517 Y4951H unknown Het
Usf1 T A 1: 171,415,805 V50D possibly damaging Het
Utp6 A T 11: 79,936,025 M575K probably benign Het
Vmn1r197 A T 13: 22,328,438 R176S possibly damaging Het
Vmn2r94 A G 17: 18,277,489 F7S possibly damaging Het
Vps41 G T 13: 18,829,231 E340* probably null Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20038239 missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20048096 missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20042793 missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20042896 missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20040668 missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20029925 missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20041794 nonsense probably null
IGL02305:Vmn2r104 APN 17 20042856 missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20042786 missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20042821 missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20029604 missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20041813 missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20029807 missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20029627 missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20048002 nonsense probably null
R0709:Vmn2r104 UTSW 17 20042904 missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20042725 missense probably benign
R1575:Vmn2r104 UTSW 17 20042215 missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20042235 missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20040769 missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20042051 missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20048193 missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20029556 missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20029921 missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20029885 missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20042241 missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20048181 missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20040768 nonsense probably null
R4911:Vmn2r104 UTSW 17 20030026 missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20038266 missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20041884 missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20029901 missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20030188 missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20030081 missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20040719 nonsense probably null
R5795:Vmn2r104 UTSW 17 20030110 missense probably benign 0.02
R5795:Vmn2r104 UTSW 17 20030282 missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20029471 missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20041708 missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20029485 missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20038311 missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20041647 missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20030245 missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20041567 missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20029586 missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20042225 missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20030096 missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20040826 missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20029475 missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20029529 missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20041709 missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20042726 missense probably benign
R8031:Vmn2r104 UTSW 17 20042786 missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20030221 missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20030203 missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20040778 missense possibly damaging 0.55
R8691:Vmn2r104 UTSW 17 20041848 missense probably damaging 0.98
R8795:Vmn2r104 UTSW 17 20042726 missense probably benign
R8900:Vmn2r104 UTSW 17 20041662 missense probably damaging 0.99
R8913:Vmn2r104 UTSW 17 20029706 missense probably damaging 1.00
R9180:Vmn2r104 UTSW 17 20042825 missense probably benign 0.00
R9199:Vmn2r104 UTSW 17 20041835 missense probably damaging 0.99
R9303:Vmn2r104 UTSW 17 20048177 missense possibly damaging 0.90
R9305:Vmn2r104 UTSW 17 20048177 missense possibly damaging 0.90
R9322:Vmn2r104 UTSW 17 20042825 missense probably benign 0.00
R9325:Vmn2r104 UTSW 17 20048171 missense possibly damaging 0.95
R9414:Vmn2r104 UTSW 17 20029988 missense probably damaging 0.99
RF007:Vmn2r104 UTSW 17 20048040 missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20029789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGATAAAGACAACTGTTGACCC -3'
(R):5'- CAGTAGTGATTGATTGCTTACTTGAGC -3'

Sequencing Primer
(F):5'- ACAACTGTTGACCCTGAGGAGC -3'
(R):5'- TTCAGAAGCAGAATGGTAGTTTG -3'
Posted On 2022-03-25