Incidental Mutation 'R9282:Pdzd7'
ID 703720
Institutional Source Beutler Lab
Gene Symbol Pdzd7
Ensembl Gene ENSMUSG00000074818
Gene Name PDZ domain containing 7
Synonyms Pdzk7, EG435601
Accession Numbers

Genbank: NM_001195265

Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock # R9282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 45026906-45046614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45040183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 174 (F174L)
Ref Sequence ENSEMBL: ENSMUSP00000119002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145391] [ENSMUST00000169459]
AlphaFold E9Q9W7
Predicted Effect probably damaging
Transcript: ENSMUST00000145391
AA Change: F174L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169459
AA Change: F174L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818
AA Change: F174L

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary protein homologous to proteins which are mutated in Usher syndrome patients, and mutations and translocations involving this gene have been associated with two types of Usher syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit profound deafness due to abnormal outer cochlear hair cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp G A 16: 56,620,504 V701M unknown Het
Adam2 G A 14: 66,029,789 P674S probably benign Het
Adam24 T A 8: 40,680,635 Y381N probably damaging Het
Adgrv1 A G 13: 81,103,372 S6209P probably damaging Het
Aox4 A T 1: 58,245,869 K593N possibly damaging Het
Aqp3 A G 4: 41,093,640 V258A possibly damaging Het
Atg16l1 T A 1: 87,780,184 F390I possibly damaging Het
B4galt6 T A 18: 20,692,452 Y239F possibly damaging Het
Cmtr2 T C 8: 110,222,345 M429T probably benign Het
Col5a2 C G 1: 45,438,869 probably null Het
Dcc T C 18: 71,682,178 D375G possibly damaging Het
Dnah14 T C 1: 181,814,512 Y31H Het
Fam131a G A 16: 20,701,493 R232H possibly damaging Het
Fam186a A G 15: 99,941,998 Y2122H probably damaging Het
Focad A T 4: 88,196,822 I421F unknown Het
Fscb T G 12: 64,473,323 E456D possibly damaging Het
Furin C A 7: 80,391,098 S664I probably benign Het
Ganc A G 2: 120,459,900 E906G probably benign Het
Gdf5 C G 2: 155,941,995 D346H probably damaging Het
Golga4 T C 9: 118,556,825 L1005P probably damaging Het
Ifit1bl1 T C 19: 34,594,508 N183S probably benign Het
Itpr1 T A 6: 108,394,023 F1084I probably damaging Het
Katnal1 A T 5: 148,894,211 Y184* probably null Het
Lrrc37a A G 11: 103,500,807 I1264T probably benign Het
Map3k2 T A 18: 32,209,752 M234K probably damaging Het
Mcm3ap T A 10: 76,506,518 V1615E probably damaging Het
Mkrn2 A G 6: 115,614,573 probably null Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nradd T A 9: 110,621,683 Q142L possibly damaging Het
Olfr689 T C 7: 105,314,574 I190T probably benign Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pi4k2b C T 5: 52,743,537 T99I probably benign Het
Pigv A T 4: 133,664,662 V399D probably damaging Het
Pla2g4a C A 1: 149,871,456 L326F probably damaging Het
Psmg1 T C 16: 95,989,517 I73M probably damaging Het
Rcl1 T C 19: 29,115,770 S62P probably damaging Het
Slc23a4 T A 6: 34,978,926 I58F probably damaging Het
Slc36a2 G T 11: 55,170,011 T191K probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tbc1d30 T C 10: 121,306,223 probably null Het
Tbc1d4 A G 14: 101,608,180 V94A possibly damaging Het
Tdrd5 T C 1: 156,277,460 Y532C probably benign Het
Tll2 T A 19: 41,086,333 I931L probably benign Het
Tlr3 T C 8: 45,398,606 N418S probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tshr T A 12: 91,507,744 M164K possibly damaging Het
Ttc21b A G 2: 66,226,005 V679A possibly damaging Het
Ttn A G 2: 76,900,517 Y4951H unknown Het
Usf1 T A 1: 171,415,805 V50D possibly damaging Het
Utp6 A T 11: 79,936,025 M575K probably benign Het
Vmn1r197 A T 13: 22,328,438 R176S possibly damaging Het
Vmn2r104 A T 17: 20,040,836 F442I probably damaging Het
Vmn2r94 A G 17: 18,277,489 F7S possibly damaging Het
Vps41 G T 13: 18,829,231 E340* probably null Het
Other mutations in Pdzd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Pdzd7 APN 19 45040258 missense probably damaging 1.00
IGL02729:Pdzd7 APN 19 45045643 start codon destroyed probably null 0.89
F6893:Pdzd7 UTSW 19 45036734 missense probably damaging 0.98
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0295:Pdzd7 UTSW 19 45037072 missense probably benign 0.01
R0523:Pdzd7 UTSW 19 45036090 missense probably benign 0.01
R0645:Pdzd7 UTSW 19 45045475 missense possibly damaging 0.95
R0731:Pdzd7 UTSW 19 45029305 missense probably damaging 1.00
R1265:Pdzd7 UTSW 19 45040685 missense possibly damaging 0.64
R1711:Pdzd7 UTSW 19 45045511 missense possibly damaging 0.68
R1789:Pdzd7 UTSW 19 45039228 missense probably damaging 1.00
R1817:Pdzd7 UTSW 19 45036176 missense probably damaging 0.98
R2162:Pdzd7 UTSW 19 45036055 critical splice donor site probably null
R2851:Pdzd7 UTSW 19 45027674 missense probably benign
R2852:Pdzd7 UTSW 19 45027674 missense probably benign
R2939:Pdzd7 UTSW 19 45045423 missense possibly damaging 0.89
R3832:Pdzd7 UTSW 19 45040254 missense probably damaging 1.00
R3874:Pdzd7 UTSW 19 45045628 missense probably benign
R4416:Pdzd7 UTSW 19 45040580 missense probably damaging 1.00
R4668:Pdzd7 UTSW 19 45045687 start gained probably benign
R5133:Pdzd7 UTSW 19 45028429 missense possibly damaging 0.51
R5327:Pdzd7 UTSW 19 45028777 missense probably benign
R5458:Pdzd7 UTSW 19 45027791 missense probably benign
R5480:Pdzd7 UTSW 19 45039285 missense possibly damaging 0.65
R5644:Pdzd7 UTSW 19 45040180 missense probably benign 0.16
R5799:Pdzd7 UTSW 19 45036989 missense probably benign 0.06
R5812:Pdzd7 UTSW 19 45036871 missense probably damaging 1.00
R5873:Pdzd7 UTSW 19 45027949 missense probably damaging 1.00
R6669:Pdzd7 UTSW 19 45036751 missense possibly damaging 0.94
R6750:Pdzd7 UTSW 19 45027748 missense probably benign
R7128:Pdzd7 UTSW 19 45027949 missense probably damaging 0.99
R7183:Pdzd7 UTSW 19 45037114 missense probably benign
R7378:Pdzd7 UTSW 19 45045606 missense probably damaging 0.99
R7395:Pdzd7 UTSW 19 45037011 missense probably damaging 1.00
R7426:Pdzd7 UTSW 19 45033647 missense possibly damaging 0.68
R7790:Pdzd7 UTSW 19 45045523 nonsense probably null
R7792:Pdzd7 UTSW 19 45040218 missense possibly damaging 0.54
R7829:Pdzd7 UTSW 19 45039239 missense probably benign 0.00
R7883:Pdzd7 UTSW 19 45030240 missense probably damaging 1.00
R7969:Pdzd7 UTSW 19 45036225 missense probably benign 0.01
R8387:Pdzd7 UTSW 19 45030051 missense probably damaging 1.00
R8720:Pdzd7 UTSW 19 45036228 missense probably benign 0.27
R8830:Pdzd7 UTSW 19 45033073 missense probably damaging 1.00
R9417:Pdzd7 UTSW 19 45045583 missense probably damaging 1.00
R9453:Pdzd7 UTSW 19 45027617 makesense probably null
Predicted Primers PCR Primer
(F):5'- TAAGCAGCCGCAACATACTG -3'
(R):5'- ATCCCACTTCGAGGATTCAC -3'

Sequencing Primer
(F):5'- GCAACATACTGCGCCCG -3'
(R):5'- GAGGATTCACCCTTCCCTGC -3'
Posted On 2022-03-25