Incidental Mutation 'R9283:Cry2'
ID 703726
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Name cryptochrome 2 (photolyase-like)
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock # R9283 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 92403646-92434043 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92413904 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 308 (L308P)
Ref Sequence ENSEMBL: ENSMUSP00000088047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
AlphaFold Q9R194
PDB Structure A vertebrate cryptochrome [X-RAY DIFFRACTION]
a vertebrate cryptochrome with FAD [X-RAY DIFFRACTION]
A ubiquitin ligase-substrate complex [X-RAY DIFFRACTION]
Mammalian cryptochrome in complex with a small molecule competitor of its ubiquitin ligase [X-RAY DIFFRACTION]
Crystal Structure of Mammalian Period-Cryptochrome Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000090559
AA Change: L308P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: L308P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111278
AA Change: L308P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: L308P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,350,064 V47A probably benign Het
Aamdc A G 7: 97,550,635 V140A probably benign Het
Acsm3 T A 7: 119,773,892 M206K possibly damaging Het
Adprhl1 T C 8: 13,223,540 T1073A probably benign Het
Aoc1 A G 6: 48,905,327 I46V probably benign Het
Ap4b1 A G 3: 103,814,943 S246G probably damaging Het
Bach1 A G 16: 87,719,323 T251A probably benign Het
Daam1 G T 12: 71,988,922 G964C probably damaging Het
Ddx10 T G 9: 53,235,356 N189H probably benign Het
Dlg4 T A 11: 70,031,791 C241* probably null Het
Dpy19l1 G T 9: 24,421,116 Y489* probably null Het
E2f4 C A 8: 105,297,763 A8E probably benign Het
Gm3486 T C 14: 41,488,311 N71S possibly damaging Het
Ighv1-23 A G 12: 114,764,605 W66R probably damaging Het
Kcnh5 A G 12: 74,976,533 L587P probably damaging Het
Kctd16 T C 18: 40,259,180 Y274H possibly damaging Het
Kif16b T A 2: 142,712,980 M633L probably benign Het
Kif23 T C 9: 61,945,369 N21S probably benign Het
Lamtor3 C T 3: 137,927,362 R85C probably benign Het
Lin9 A T 1: 180,665,928 T240S probably damaging Het
Mtus1 C A 8: 41,083,482 G399V probably benign Het
Mup8 C T 4: 60,221,903 V77I probably benign Het
Myo5b C T 18: 74,644,078 A403V probably benign Het
Naf1 C A 8: 66,860,851 A162E unknown Het
Nat10 G A 2: 103,725,747 Q910* probably null Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Npas2 A G 1: 39,287,608 K58R probably damaging Het
Nsd2 A T 5: 33,843,714 I192F probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Olfr1445 T A 19: 12,884,597 C239S probably damaging Het
Olfr1458 C A 19: 13,102,457 M282I probably damaging Het
Olfr518 C T 7: 108,881,082 A175T probably benign Het
Olfr710 G A 7: 106,944,599 T134I probably benign Het
Olfr873 A G 9: 20,301,123 K309E possibly damaging Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pcdh17 C T 14: 84,448,153 P687S possibly damaging Het
Pdpr C T 8: 111,129,636 R664W possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pfas A T 11: 68,993,882 V498E probably damaging Het
Pfpl A T 19: 12,428,856 Y157F probably damaging Het
Piezo2 A T 18: 63,024,566 F2358I probably damaging Het
Pip5k1b T C 19: 24,360,012 Y304C probably damaging Het
Pls1 G A 9: 95,773,589 A370V probably benign Het
Polm A T 11: 5,829,050 L490H probably damaging Het
Prdm5 T C 6: 65,881,076 C375R probably damaging Het
Scmh1 A T 4: 120,462,140 M21L probably benign Het
Sec16a C A 2: 26,423,892 R449S Het
Sin3a C T 9: 57,095,433 T203I probably damaging Het
Six5 A G 7: 19,095,223 E196G probably damaging Het
Skint8 T C 4: 111,928,447 V30A probably damaging Het
Slc2a12 G A 10: 22,664,612 G122E probably damaging Het
Smim14 A G 5: 65,468,437 C11R probably damaging Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tanc1 T C 2: 59,799,830 I718T probably damaging Het
Tead4 A G 6: 128,228,629 L370P probably damaging Het
Tnrc6c A G 11: 117,700,804 K15E unknown Het
Trim55 T G 3: 19,645,448 probably null Het
Trpm1 A T 7: 64,223,875 N510I probably benign Het
Trps1 A G 15: 50,831,051 V616A probably damaging Het
Usp42 A T 5: 143,719,509 V405E probably damaging Het
Zfp11 A T 5: 129,657,684 S238T probably damaging Het
Zfp608 T C 18: 54,897,841 H1009R possibly damaging Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92424632 missense probably benign 0.15
IGL02167:Cry2 APN 2 92433821 missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92413039 missense probably damaging 0.99
IGL02343:Cry2 APN 2 92426921 missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92413667 missense probably damaging 0.99
IGL02725:Cry2 APN 2 92413260 splice site probably benign
IGL02932:Cry2 APN 2 92413117 nonsense probably null
IGL03122:Cry2 APN 2 92413295 missense probably damaging 1.00
IGL03366:Cry2 APN 2 92413715 missense probably damaging 1.00
R0679:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R1325:Cry2 UTSW 2 92413770 missense probably damaging 1.00
R1862:Cry2 UTSW 2 92424566 missense probably damaging 1.00
R1891:Cry2 UTSW 2 92413640 missense possibly damaging 0.93
R2189:Cry2 UTSW 2 92411692 missense possibly damaging 0.84
R4032:Cry2 UTSW 2 92413827 missense probably benign 0.00
R4689:Cry2 UTSW 2 92424554 missense probably benign 0.38
R5130:Cry2 UTSW 2 92424599 missense probably benign 0.28
R5145:Cry2 UTSW 2 92413060 missense probably benign
R5970:Cry2 UTSW 2 92412967 missense probably benign 0.08
R6179:Cry2 UTSW 2 92413842 missense probably damaging 0.98
R7102:Cry2 UTSW 2 92413093 missense probably damaging 0.99
R7158:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R7213:Cry2 UTSW 2 92413659 missense probably benign 0.00
R7257:Cry2 UTSW 2 92412981 missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92413664 missense probably damaging 1.00
R7427:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92413638 missense probably damaging 1.00
R7531:Cry2 UTSW 2 92413005 missense probably damaging 0.98
R8234:Cry2 UTSW 2 92412629 missense probably benign
R8350:Cry2 UTSW 2 92413941 missense probably benign 0.00
R8450:Cry2 UTSW 2 92413941 missense probably benign 0.00
R8496:Cry2 UTSW 2 92426939 missense probably damaging 1.00
R9172:Cry2 UTSW 2 92413648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATGATGGCGTCAATCC -3'
(R):5'- TGAAGCCATTCTTGGTGCC -3'

Sequencing Primer
(F):5'- TCAATCCAAGGGAAGCCTGTCTTG -3'
(R):5'- GCTGCATGTTGTACACTGAGAATC -3'
Posted On 2022-03-25