Mutagenetix > Incidental Mutations

Incidental Mutation 'R9283:Cry2'

703726

Institutional Source

Beutler Lab

Gene Symbol

Cry2

Ensembl Gene

ENSMUSG00000068742

Gene Name

cryptochrome 2 (photolyase-like)

Synonyms

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R9283 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92403646-92434043 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92413904 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 308 (L308P)

Ref Sequence

ENSEMBL: ENSMUSP00000088047 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]

AlphaFold

Q9R194

PDB Structure

A vertebrate cryptochrome [X-RAY DIFFRACTION]
a vertebrate cryptochrome with FAD [X-RAY DIFFRACTION]
A ubiquitin ligase-substrate complex [X-RAY DIFFRACTION]
Mammalian cryptochrome in complex with a small molecule competitor of its ubiquitin ligase [X-RAY DIFFRACTION]
Crystal Structure of Mammalian Period-Cryptochrome Complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000090559
AA Change: L308P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: L308P

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:DNA_photolyase	23	187	2.4e-50	PFAM
Pfam:FAD_binding_7	231	504	4.4e-89	PFAM
low complexity region	562	573	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111278
AA Change: L308P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: L308P

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:DNA_photolyase	23	189	3.6e-50	PFAM
Pfam:FAD_binding_7	230	506	1.4e-105	PFAM
low complexity region	562	573	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaas	A	G	15: 102,350,064	V47A	probably benign	Het
Aamdc	A	G	7: 97,550,635	V140A	probably benign	Het
Acsm3	T	A	7: 119,773,892	M206K	possibly damaging	Het
Adprhl1	T	C	8: 13,223,540	T1073A	probably benign	Het
Aoc1	A	G	6: 48,905,327	I46V	probably benign	Het
Ap4b1	A	G	3: 103,814,943	S246G	probably damaging	Het
Bach1	A	G	16: 87,719,323	T251A	probably benign	Het
Daam1	G	T	12: 71,988,922	G964C	probably damaging	Het
Ddx10	T	G	9: 53,235,356	N189H	probably benign	Het
Dlg4	T	A	11: 70,031,791	C241*	probably null	Het
Dpy19l1	G	T	9: 24,421,116	Y489*	probably null	Het
E2f4	C	A	8: 105,297,763	A8E	probably benign	Het
Gm3486	T	C	14: 41,488,311	N71S	possibly damaging	Het
Ighv1-23	A	G	12: 114,764,605	W66R	probably damaging	Het
Kcnh5	A	G	12: 74,976,533	L587P	probably damaging	Het
Kctd16	T	C	18: 40,259,180	Y274H	possibly damaging	Het
Kif16b	T	A	2: 142,712,980	M633L	probably benign	Het
Kif23	T	C	9: 61,945,369	N21S	probably benign	Het
Lamtor3	C	T	3: 137,927,362	R85C	probably benign	Het
Lin9	A	T	1: 180,665,928	T240S	probably damaging	Het
Mtus1	C	A	8: 41,083,482	G399V	probably benign	Het
Mup8	C	T	4: 60,221,903	V77I	probably benign	Het
Myo5b	C	T	18: 74,644,078	A403V	probably benign	Het
Naf1	C	A	8: 66,860,851	A162E	unknown	Het
Nat10	G	A	2: 103,725,747	Q910*	probably null	Het
Nos1	G	C	5: 117,879,337	R255P	probably benign	Het
Npas2	A	G	1: 39,287,608	K58R	probably damaging	Het
Nsd2	A	T	5: 33,843,714	I192F	probably benign	Het
Nup98	C	A	7: 102,138,830	R1011L	probably benign	Het
Olfr1445	T	A	19: 12,884,597	C239S	probably damaging	Het
Olfr1458	C	A	19: 13,102,457	M282I	probably damaging	Het
Olfr518	C	T	7: 108,881,082	A175T	probably benign	Het
Olfr710	G	A	7: 106,944,599	T134I	probably benign	Het
Olfr873	A	G	9: 20,301,123	K309E	possibly damaging	Het
Ophn1	G	A	X: 98,578,539	T668M	probably benign	Het
Pcdh17	C	T	14: 84,448,153	P687S	possibly damaging	Het
Pdpr	C	T	8: 111,129,636	R664W	possibly damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Pfas	A	T	11: 68,993,882	V498E	probably damaging	Het
Pfpl	A	T	19: 12,428,856	Y157F	probably damaging	Het
Piezo2	A	T	18: 63,024,566	F2358I	probably damaging	Het
Pip5k1b	T	C	19: 24,360,012	Y304C	probably damaging	Het
Pls1	G	A	9: 95,773,589	A370V	probably benign	Het
Polm	A	T	11: 5,829,050	L490H	probably damaging	Het
Prdm5	T	C	6: 65,881,076	C375R	probably damaging	Het
Scmh1	A	T	4: 120,462,140	M21L	probably benign	Het
Sec16a	C	A	2: 26,423,892	R449S		Het
Sin3a	C	T	9: 57,095,433	T203I	probably damaging	Het
Six5	A	G	7: 19,095,223	E196G	probably damaging	Het
Skint8	T	C	4: 111,928,447	V30A	probably damaging	Het
Slc2a12	G	A	10: 22,664,612	G122E	probably damaging	Het
Smim14	A	G	5: 65,468,437	C11R	probably damaging	Het
Sorbs2	T	G	8: 45,795,737	V675G	probably benign	Het
Tanc1	T	C	2: 59,799,830	I718T	probably damaging	Het
Tead4	A	G	6: 128,228,629	L370P	probably damaging	Het
Tnrc6c	A	G	11: 117,700,804	K15E	unknown	Het
Trim55	T	G	3: 19,645,448		probably null	Het
Trpm1	A	T	7: 64,223,875	N510I	probably benign	Het
Trps1	A	G	15: 50,831,051	V616A	probably damaging	Het
Usp42	A	T	5: 143,719,509	V405E	probably damaging	Het
Zfp11	A	T	5: 129,657,684	S238T	probably damaging	Het
Zfp608	T	C	18: 54,897,841	H1009R	possibly damaging	Het

Other mutations in Cry2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01995:Cry2	APN	2	92424632	missense	probably benign	0.15
IGL02167:Cry2	APN	2	92433821	missense	possibly damaging	0.93
IGL02183:Cry2	APN	2	92413039	missense	probably damaging	0.99
IGL02343:Cry2	APN	2	92426921	missense	possibly damaging	0.90
IGL02432:Cry2	APN	2	92413667	missense	probably damaging	0.99
IGL02725:Cry2	APN	2	92413260	splice site	probably benign
IGL02932:Cry2	APN	2	92413117	nonsense	probably null
IGL03122:Cry2	APN	2	92413295	missense	probably damaging	1.00
IGL03366:Cry2	APN	2	92413715	missense	probably damaging	1.00
R0679:Cry2	UTSW	2	92413715	missense	probably damaging	1.00
R1325:Cry2	UTSW	2	92413770	missense	probably damaging	1.00
R1862:Cry2	UTSW	2	92424566	missense	probably damaging	1.00
R1891:Cry2	UTSW	2	92413640	missense	possibly damaging	0.93
R2189:Cry2	UTSW	2	92411692	missense	possibly damaging	0.84
R4032:Cry2	UTSW	2	92413827	missense	probably benign	0.00
R4689:Cry2	UTSW	2	92424554	missense	probably benign	0.38
R5130:Cry2	UTSW	2	92424599	missense	probably benign	0.28
R5145:Cry2	UTSW	2	92413060	missense	probably benign
R5970:Cry2	UTSW	2	92412967	missense	probably benign	0.08
R6179:Cry2	UTSW	2	92413842	missense	probably damaging	0.98
R7102:Cry2	UTSW	2	92413093	missense	probably damaging	0.99
R7158:Cry2	UTSW	2	92413715	missense	probably damaging	1.00
R7213:Cry2	UTSW	2	92413659	missense	probably benign	0.00
R7257:Cry2	UTSW	2	92412981	missense	possibly damaging	0.67
R7378:Cry2	UTSW	2	92413664	missense	probably damaging	1.00
R7427:Cry2	UTSW	2	92413047	missense	possibly damaging	0.74
R7428:Cry2	UTSW	2	92413047	missense	possibly damaging	0.74
R7440:Cry2	UTSW	2	92413638	missense	probably damaging	1.00
R7531:Cry2	UTSW	2	92413005	missense	probably damaging	0.98
R8234:Cry2	UTSW	2	92412629	missense	probably benign
R8350:Cry2	UTSW	2	92413941	missense	probably benign	0.00
R8450:Cry2	UTSW	2	92413941	missense	probably benign	0.00
R8496:Cry2	UTSW	2	92426939	missense	probably damaging	1.00
R9172:Cry2	UTSW	2	92413648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCATGATGGCGTCAATCC -3'
(R):5'- TGAAGCCATTCTTGGTGCC -3'

Sequencing Primer
(F):5'- TCAATCCAAGGGAAGCCTGTCTTG -3'
(R):5'- GCTGCATGTTGTACACTGAGAATC -3'

Posted On

2022-03-25