Incidental Mutation 'R9283:Pfas'
ID 703765
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Name phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms 4432409B16Rik, Sofa
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9283 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 68985697-69008460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68993882 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 498 (V498E)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
AlphaFold Q5SUR0
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: V498E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: V498E

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899
AA Change: V52E

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152964
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,350,064 V47A probably benign Het
Aamdc A G 7: 97,550,635 V140A probably benign Het
Acsm3 T A 7: 119,773,892 M206K possibly damaging Het
Adprhl1 T C 8: 13,223,540 T1073A probably benign Het
Aoc1 A G 6: 48,905,327 I46V probably benign Het
Ap4b1 A G 3: 103,814,943 S246G probably damaging Het
Bach1 A G 16: 87,719,323 T251A probably benign Het
Cry2 A G 2: 92,413,904 L308P probably damaging Het
Daam1 G T 12: 71,988,922 G964C probably damaging Het
Ddx10 T G 9: 53,235,356 N189H probably benign Het
Dlg4 T A 11: 70,031,791 C241* probably null Het
Dpy19l1 G T 9: 24,421,116 Y489* probably null Het
E2f4 C A 8: 105,297,763 A8E probably benign Het
Gm3486 T C 14: 41,488,311 N71S possibly damaging Het
Ighv1-23 A G 12: 114,764,605 W66R probably damaging Het
Kcnh5 A G 12: 74,976,533 L587P probably damaging Het
Kctd16 T C 18: 40,259,180 Y274H possibly damaging Het
Kif16b T A 2: 142,712,980 M633L probably benign Het
Kif23 T C 9: 61,945,369 N21S probably benign Het
Lamtor3 C T 3: 137,927,362 R85C probably benign Het
Lin9 A T 1: 180,665,928 T240S probably damaging Het
Mtus1 C A 8: 41,083,482 G399V probably benign Het
Mup8 C T 4: 60,221,903 V77I probably benign Het
Myo5b C T 18: 74,644,078 A403V probably benign Het
Naf1 C A 8: 66,860,851 A162E unknown Het
Nat10 G A 2: 103,725,747 Q910* probably null Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Npas2 A G 1: 39,287,608 K58R probably damaging Het
Nsd2 A T 5: 33,843,714 I192F probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Olfr1445 T A 19: 12,884,597 C239S probably damaging Het
Olfr1458 C A 19: 13,102,457 M282I probably damaging Het
Olfr518 C T 7: 108,881,082 A175T probably benign Het
Olfr710 G A 7: 106,944,599 T134I probably benign Het
Olfr873 A G 9: 20,301,123 K309E possibly damaging Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pcdh17 C T 14: 84,448,153 P687S possibly damaging Het
Pdpr C T 8: 111,129,636 R664W possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pfpl A T 19: 12,428,856 Y157F probably damaging Het
Piezo2 A T 18: 63,024,566 F2358I probably damaging Het
Pip5k1b T C 19: 24,360,012 Y304C probably damaging Het
Pls1 G A 9: 95,773,589 A370V probably benign Het
Polm A T 11: 5,829,050 L490H probably damaging Het
Prdm5 T C 6: 65,881,076 C375R probably damaging Het
Scmh1 A T 4: 120,462,140 M21L probably benign Het
Sec16a C A 2: 26,423,892 R449S Het
Sin3a C T 9: 57,095,433 T203I probably damaging Het
Six5 A G 7: 19,095,223 E196G probably damaging Het
Skint8 T C 4: 111,928,447 V30A probably damaging Het
Slc2a12 G A 10: 22,664,612 G122E probably damaging Het
Smim14 A G 5: 65,468,437 C11R probably damaging Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tanc1 T C 2: 59,799,830 I718T probably damaging Het
Tead4 A G 6: 128,228,629 L370P probably damaging Het
Tnrc6c A G 11: 117,700,804 K15E unknown Het
Trim55 T G 3: 19,645,448 probably null Het
Trpm1 A T 7: 64,223,875 N510I probably benign Het
Trps1 A G 15: 50,831,051 V616A probably damaging Het
Usp42 A T 5: 143,719,509 V405E probably damaging Het
Zfp11 A T 5: 129,657,684 S238T probably damaging Het
Zfp608 T C 18: 54,897,841 H1009R possibly damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 splice site probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1871:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2026:Pfas UTSW 11 68993957 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4437:Pfas UTSW 11 68988417 missense probably damaging 1.00
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R4763:Pfas UTSW 11 68990194 missense possibly damaging 0.81
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5328:Pfas UTSW 11 68988592 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6387:Pfas UTSW 11 69000465 missense probably damaging 1.00
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7386:Pfas UTSW 11 69003774 missense probably benign
R7424:Pfas UTSW 11 69000092 missense probably damaging 1.00
R7459:Pfas UTSW 11 68988655 missense
R7593:Pfas UTSW 11 68991095 missense
R7731:Pfas UTSW 11 69000045 missense probably damaging 1.00
R8103:Pfas UTSW 11 68992293 missense probably damaging 0.98
R8248:Pfas UTSW 11 69000263 missense probably damaging 1.00
R8804:Pfas UTSW 11 68991082 missense
R8853:Pfas UTSW 11 68992918 missense probably damaging 1.00
R9032:Pfas UTSW 11 68988595 missense
R9050:Pfas UTSW 11 68991741 missense probably benign 0.01
Z1176:Pfas UTSW 11 68990070 missense
Z1176:Pfas UTSW 11 69002487 missense probably damaging 1.00
Z1177:Pfas UTSW 11 68990225 missense probably damaging 1.00
Z1177:Pfas UTSW 11 69002493 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATCTAGTCATGGTCAGCCCC -3'
(R):5'- ACCTTTCCTATGACTGGGCC -3'

Sequencing Primer
(F):5'- GCCTCCATAGTGCCTAAAATCCTG -3'
(R):5'- TATGACTGGGCCCCACTGTG -3'
Posted On 2022-03-25