Incidental Mutation 'R9283:Tnrc6c'
ID 703767
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Name trinucleotide repeat containing 6C
Synonyms 9930033H14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9283 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 117654289-117763439 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 117700804 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 15 (K15E)
Ref Sequence ENSEMBL: ENSMUSP00000026658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000026658
AA Change: K15E
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: K15E

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106344
AA Change: K15E
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: K15E

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,350,064 V47A probably benign Het
Aamdc A G 7: 97,550,635 V140A probably benign Het
Acsm3 T A 7: 119,773,892 M206K possibly damaging Het
Adprhl1 T C 8: 13,223,540 T1073A probably benign Het
Aoc1 A G 6: 48,905,327 I46V probably benign Het
Ap4b1 A G 3: 103,814,943 S246G probably damaging Het
Bach1 A G 16: 87,719,323 T251A probably benign Het
Cry2 A G 2: 92,413,904 L308P probably damaging Het
Daam1 G T 12: 71,988,922 G964C probably damaging Het
Ddx10 T G 9: 53,235,356 N189H probably benign Het
Dlg4 T A 11: 70,031,791 C241* probably null Het
Dpy19l1 G T 9: 24,421,116 Y489* probably null Het
E2f4 C A 8: 105,297,763 A8E probably benign Het
Gm3486 T C 14: 41,488,311 N71S possibly damaging Het
Ighv1-23 A G 12: 114,764,605 W66R probably damaging Het
Kcnh5 A G 12: 74,976,533 L587P probably damaging Het
Kctd16 T C 18: 40,259,180 Y274H possibly damaging Het
Kif16b T A 2: 142,712,980 M633L probably benign Het
Kif23 T C 9: 61,945,369 N21S probably benign Het
Lamtor3 C T 3: 137,927,362 R85C probably benign Het
Lin9 A T 1: 180,665,928 T240S probably damaging Het
Mtus1 C A 8: 41,083,482 G399V probably benign Het
Mup8 C T 4: 60,221,903 V77I probably benign Het
Myo5b C T 18: 74,644,078 A403V probably benign Het
Naf1 C A 8: 66,860,851 A162E unknown Het
Nat10 G A 2: 103,725,747 Q910* probably null Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Npas2 A G 1: 39,287,608 K58R probably damaging Het
Nsd2 A T 5: 33,843,714 I192F probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Olfr1445 T A 19: 12,884,597 C239S probably damaging Het
Olfr1458 C A 19: 13,102,457 M282I probably damaging Het
Olfr518 C T 7: 108,881,082 A175T probably benign Het
Olfr710 G A 7: 106,944,599 T134I probably benign Het
Olfr873 A G 9: 20,301,123 K309E possibly damaging Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pcdh17 C T 14: 84,448,153 P687S possibly damaging Het
Pdpr C T 8: 111,129,636 R664W possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pfas A T 11: 68,993,882 V498E probably damaging Het
Pfpl A T 19: 12,428,856 Y157F probably damaging Het
Piezo2 A T 18: 63,024,566 F2358I probably damaging Het
Pip5k1b T C 19: 24,360,012 Y304C probably damaging Het
Pls1 G A 9: 95,773,589 A370V probably benign Het
Polm A T 11: 5,829,050 L490H probably damaging Het
Prdm5 T C 6: 65,881,076 C375R probably damaging Het
Scmh1 A T 4: 120,462,140 M21L probably benign Het
Sec16a C A 2: 26,423,892 R449S Het
Sin3a C T 9: 57,095,433 T203I probably damaging Het
Six5 A G 7: 19,095,223 E196G probably damaging Het
Skint8 T C 4: 111,928,447 V30A probably damaging Het
Slc2a12 G A 10: 22,664,612 G122E probably damaging Het
Smim14 A G 5: 65,468,437 C11R probably damaging Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tanc1 T C 2: 59,799,830 I718T probably damaging Het
Tead4 A G 6: 128,228,629 L370P probably damaging Het
Trim55 T G 3: 19,645,448 probably null Het
Trpm1 A T 7: 64,223,875 N510I probably benign Het
Trps1 A G 15: 50,831,051 V616A probably damaging Het
Usp42 A T 5: 143,719,509 V405E probably damaging Het
Zfp11 A T 5: 129,657,684 S238T probably damaging Het
Zfp608 T C 18: 54,897,841 H1009R possibly damaging Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117720971 missense probably benign
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117721046 missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117722519 missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117733618 missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117741780 missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117721954 missense probably benign
R7515:Tnrc6c UTSW 11 117741681 missense probably benign 0.03
R7665:Tnrc6c UTSW 11 117720951 missense possibly damaging 0.46
R7755:Tnrc6c UTSW 11 117758086 missense probably benign 0.00
R8679:Tnrc6c UTSW 11 117714135 missense probably benign
R8824:Tnrc6c UTSW 11 117739854 splice site probably benign
R8971:Tnrc6c UTSW 11 117749263 missense possibly damaging 0.95
R9261:Tnrc6c UTSW 11 117714279 missense probably damaging 0.99
R9342:Tnrc6c UTSW 11 117739894 missense probably benign 0.01
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Z1176:Tnrc6c UTSW 11 117732177 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTCTGCACAAATAATATCCCGATCC -3'
(R):5'- GTAGCTGGCATTGTTCTCGC -3'

Sequencing Primer
(F):5'- TTGAGTTTCAAACCCAGGGC -3'
(R):5'- TCGCTTCACTAGTCAAGTATCTATAG -3'
Posted On 2022-03-25