Incidental Mutation 'R9283:Daam1'
ID 703768
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Name dishevelled associated activator of morphogenesis 1
Synonyms 1700066F09Rik, 2310028E21Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9283 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 71831078-71992333 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 71988922 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 964 (G964C)
Ref Sequence ENSEMBL: ENSMUSP00000082406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
AlphaFold Q8BPM0
Predicted Effect probably damaging
Transcript: ENSMUST00000085299
AA Change: G964C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: G964C

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221317
AA Change: G955C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223272
AA Change: G964C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A G 15: 102,350,064 V47A probably benign Het
Aamdc A G 7: 97,550,635 V140A probably benign Het
Acsm3 T A 7: 119,773,892 M206K possibly damaging Het
Adprhl1 T C 8: 13,223,540 T1073A probably benign Het
Aoc1 A G 6: 48,905,327 I46V probably benign Het
Ap4b1 A G 3: 103,814,943 S246G probably damaging Het
Bach1 A G 16: 87,719,323 T251A probably benign Het
Cry2 A G 2: 92,413,904 L308P probably damaging Het
Ddx10 T G 9: 53,235,356 N189H probably benign Het
Dlg4 T A 11: 70,031,791 C241* probably null Het
Dpy19l1 G T 9: 24,421,116 Y489* probably null Het
E2f4 C A 8: 105,297,763 A8E probably benign Het
Gm3486 T C 14: 41,488,311 N71S possibly damaging Het
Ighv1-23 A G 12: 114,764,605 W66R probably damaging Het
Kcnh5 A G 12: 74,976,533 L587P probably damaging Het
Kctd16 T C 18: 40,259,180 Y274H possibly damaging Het
Kif16b T A 2: 142,712,980 M633L probably benign Het
Kif23 T C 9: 61,945,369 N21S probably benign Het
Lamtor3 C T 3: 137,927,362 R85C probably benign Het
Lin9 A T 1: 180,665,928 T240S probably damaging Het
Mtus1 C A 8: 41,083,482 G399V probably benign Het
Mup8 C T 4: 60,221,903 V77I probably benign Het
Myo5b C T 18: 74,644,078 A403V probably benign Het
Naf1 C A 8: 66,860,851 A162E unknown Het
Nat10 G A 2: 103,725,747 Q910* probably null Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Npas2 A G 1: 39,287,608 K58R probably damaging Het
Nsd2 A T 5: 33,843,714 I192F probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Olfr1445 T A 19: 12,884,597 C239S probably damaging Het
Olfr1458 C A 19: 13,102,457 M282I probably damaging Het
Olfr518 C T 7: 108,881,082 A175T probably benign Het
Olfr710 G A 7: 106,944,599 T134I probably benign Het
Olfr873 A G 9: 20,301,123 K309E possibly damaging Het
Ophn1 G A X: 98,578,539 T668M probably benign Het
Pcdh17 C T 14: 84,448,153 P687S possibly damaging Het
Pdpr C T 8: 111,129,636 R664W possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pfas A T 11: 68,993,882 V498E probably damaging Het
Pfpl A T 19: 12,428,856 Y157F probably damaging Het
Piezo2 A T 18: 63,024,566 F2358I probably damaging Het
Pip5k1b T C 19: 24,360,012 Y304C probably damaging Het
Pls1 G A 9: 95,773,589 A370V probably benign Het
Polm A T 11: 5,829,050 L490H probably damaging Het
Prdm5 T C 6: 65,881,076 C375R probably damaging Het
Scmh1 A T 4: 120,462,140 M21L probably benign Het
Sec16a C A 2: 26,423,892 R449S Het
Sin3a C T 9: 57,095,433 T203I probably damaging Het
Six5 A G 7: 19,095,223 E196G probably damaging Het
Skint8 T C 4: 111,928,447 V30A probably damaging Het
Slc2a12 G A 10: 22,664,612 G122E probably damaging Het
Smim14 A G 5: 65,468,437 C11R probably damaging Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tanc1 T C 2: 59,799,830 I718T probably damaging Het
Tead4 A G 6: 128,228,629 L370P probably damaging Het
Tnrc6c A G 11: 117,700,804 K15E unknown Het
Trim55 T G 3: 19,645,448 probably null Het
Trpm1 A T 7: 64,223,875 N510I probably benign Het
Trps1 A G 15: 50,831,051 V616A probably damaging Het
Usp42 A T 5: 143,719,509 V405E probably damaging Het
Zfp11 A T 5: 129,657,684 S238T probably damaging Het
Zfp608 T C 18: 54,897,841 H1009R possibly damaging Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
R8157:Daam1 UTSW 12 71952489 missense probably damaging 1.00
R8187:Daam1 UTSW 12 71895828 missense unknown
R8297:Daam1 UTSW 12 71951915 missense unknown
R8963:Daam1 UTSW 12 71945244 missense unknown
R9402:Daam1 UTSW 12 71959830 missense probably benign 0.09
R9563:Daam1 UTSW 12 71945477 missense unknown
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGTAAATAATTGGCTGGC -3'
(R):5'- ATCTGTCGTCATGTGGCACC -3'

Sequencing Primer
(F):5'- TAATTGGCTGGCTAAGAACCCTC -3'
(R):5'- GGGAAAGGCCAACCCACTG -3'
Posted On 2022-03-25