Incidental Mutation 'R9284:Isg20l2'
ID 703798
Institutional Source Beutler Lab
Gene Symbol Isg20l2
Ensembl Gene ENSMUSG00000048039
Gene Name interferon stimulated exonuclease gene 20-like 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R9284 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 87837621-87847993 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87838991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 67 (D67E)
Ref Sequence ENSEMBL: ENSMUSP00000059783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005016] [ENSMUST00000055984] [ENSMUST00000160074] [ENSMUST00000160143] [ENSMUST00000160648] [ENSMUST00000164439]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005016
SMART Domains Protein: ENSMUSP00000005016
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 293 1.5e-29 PFAM
low complexity region 385 402 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055984
AA Change: D67E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000059783
Gene: ENSMUSG00000048039
AA Change: D67E

DomainStartEndE-ValueType
low complexity region 128 145 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
EXOIII 193 359 3.34e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160074
SMART Domains Protein: ENSMUSP00000125365
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 69 229 1.3e-29 PFAM
low complexity region 321 338 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160143
SMART Domains Protein: ENSMUSP00000124113
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 247 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160648
Predicted Effect probably benign
Transcript: ENSMUST00000164439
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 3'-5' exoribonuclease that may be involved in the processing of the 12S pre-rRNA. Pseudogenes have been identified on chromosomes 6 and 11. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T G 4: 144,504,191 (GRCm39) Q320P probably damaging Het
Adamtsl2 G A 2: 26,994,055 (GRCm39) probably benign Het
Adgrl3 T A 5: 81,657,568 (GRCm39) probably benign Het
Angptl3 A G 4: 98,919,480 (GRCm39) Q80R probably benign Het
Atmin G A 8: 117,684,019 (GRCm39) V560M probably benign Het
Bbx A G 16: 50,045,023 (GRCm39) S513P probably benign Het
Cacng8 C A 7: 3,459,746 (GRCm39) Y112* probably null Het
Catsperg2 A G 7: 29,405,006 (GRCm39) probably null Het
Ccdc12 A C 9: 110,540,203 (GRCm39) T131P probably damaging Het
Cdh23 G A 10: 60,143,306 (GRCm39) A3005V possibly damaging Het
Cep95 A T 11: 106,704,624 (GRCm39) H493L probably benign Het
Cntnap1 A G 11: 101,068,137 (GRCm39) T50A probably benign Het
Cyp3a16 T A 5: 145,377,304 (GRCm39) I428F probably damaging Het
Dnhd1 G T 7: 105,301,091 (GRCm39) L149F probably damaging Het
Dop1b T A 16: 93,557,196 (GRCm39) V497E probably damaging Het
Erich3 A T 3: 154,404,308 (GRCm39) N55I Het
Fbxw26 A T 9: 109,550,962 (GRCm39) probably benign Het
Gm4841 A G 18: 60,403,895 (GRCm39) I66T probably damaging Het
Gp5 G A 16: 30,127,094 (GRCm39) L527F probably damaging Het
Gpatch2l G A 12: 86,290,883 (GRCm39) G22D probably benign Het
Itgae G A 11: 73,012,752 (GRCm39) V695I probably benign Het
Itpr2 A T 6: 146,256,174 (GRCm39) N1006K probably benign Het
Iws1 G A 18: 32,213,213 (GRCm39) E214K possibly damaging Het
Lama3 C T 18: 12,583,541 (GRCm39) Q710* probably null Het
Loxhd1 C T 18: 77,501,826 (GRCm39) A1715V probably damaging Het
Map3k20 C T 2: 72,228,755 (GRCm39) Q325* probably null Het
Med1 A T 11: 98,046,366 (GRCm39) S1477T unknown Het
Mr1 T A 1: 155,013,274 (GRCm39) H101L probably benign Het
Mtor T A 4: 148,543,537 (GRCm39) S405T probably benign Het
Nme9 G C 9: 99,338,321 (GRCm39) probably null Het
Nom1 T A 5: 29,647,532 (GRCm39) I589N probably damaging Het
Nr6a1 A T 2: 38,638,890 (GRCm39) D148E probably damaging Het
Nup160 T C 2: 90,548,375 (GRCm39) V1006A possibly damaging Het
Or2ag1b A T 7: 106,288,416 (GRCm39) I174N possibly damaging Het
Or2aj4 A G 16: 19,385,357 (GRCm39) I92T probably damaging Het
Or4d10b A T 19: 12,036,273 (GRCm39) L281Q probably damaging Het
Or5d37 T A 2: 87,924,278 (GRCm39) M1L probably benign Het
Or6c200-ps1 G A 10: 128,869,821 (GRCm39) P297S probably damaging Het
Phyhd1 G T 2: 30,156,879 (GRCm39) G7* probably null Het
Pla2g4e T C 2: 120,004,730 (GRCm39) probably benign Het
Ppfia3 A G 7: 45,011,222 (GRCm39) C3R probably damaging Het
Pramel1 T C 4: 143,123,769 (GRCm39) V148A probably benign Het
Ptpdc1 A T 13: 48,740,167 (GRCm39) D421E probably benign Het
Rapgef2 A T 3: 79,000,010 (GRCm39) D579E probably damaging Het
Rbpj T G 5: 53,810,724 (GRCm39) V448G probably damaging Het
Rif1 T C 2: 51,998,564 (GRCm39) V1067A probably benign Het
Scfd1 A T 12: 51,439,024 (GRCm39) N162I probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sp110 A T 1: 85,507,363 (GRCm39) probably null Het
Sparcl1 A T 5: 104,236,345 (GRCm39) C469* probably null Het
Srebf2 G A 15: 82,066,357 (GRCm39) R635Q probably benign Het
Stard7 T G 2: 127,132,956 (GRCm39) S250A probably damaging Het
Stxbp5l A C 16: 37,028,442 (GRCm39) Y540* probably null Het
Tlr5 T C 1: 182,801,377 (GRCm39) V227A probably benign Het
Tmem132b T C 5: 125,864,711 (GRCm39) I939T possibly damaging Het
Tnik G T 3: 28,593,570 (GRCm39) S142I unknown Het
Trim6 A G 7: 103,882,116 (GRCm39) T482A probably damaging Het
Tssk5 A G 15: 76,257,168 (GRCm39) I238T probably benign Het
Ugt2b35 A G 5: 87,156,140 (GRCm39) T411A probably benign Het
Zc2hc1b C A 10: 13,043,562 (GRCm39) R111L probably benign Het
Zfp266 A T 9: 20,411,300 (GRCm39) C292* probably null Het
Other mutations in Isg20l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Isg20l2 APN 3 87,839,068 (GRCm39) missense probably damaging 0.99
IGL02331:Isg20l2 APN 3 87,839,394 (GRCm39) missense probably damaging 0.99
FR4304:Isg20l2 UTSW 3 87,839,019 (GRCm39) unclassified probably benign
FR4340:Isg20l2 UTSW 3 87,839,019 (GRCm39) nonsense probably null
FR4449:Isg20l2 UTSW 3 87,839,020 (GRCm39) unclassified probably benign
FR4589:Isg20l2 UTSW 3 87,839,024 (GRCm39) unclassified probably benign
FR4976:Isg20l2 UTSW 3 87,839,022 (GRCm39) nonsense probably null
R0331:Isg20l2 UTSW 3 87,839,092 (GRCm39) missense probably damaging 1.00
R0465:Isg20l2 UTSW 3 87,838,987 (GRCm39) missense probably benign 0.01
R1398:Isg20l2 UTSW 3 87,846,061 (GRCm39) missense probably benign 0.34
R1679:Isg20l2 UTSW 3 87,839,392 (GRCm39) missense probably damaging 1.00
R3040:Isg20l2 UTSW 3 87,839,302 (GRCm39) missense probably benign
R4910:Isg20l2 UTSW 3 87,846,570 (GRCm39) missense probably damaging 1.00
R5015:Isg20l2 UTSW 3 87,839,288 (GRCm39) missense possibly damaging 0.52
R5247:Isg20l2 UTSW 3 87,838,920 (GRCm39) missense possibly damaging 0.71
R5591:Isg20l2 UTSW 3 87,837,731 (GRCm39) unclassified probably benign
R6261:Isg20l2 UTSW 3 87,839,395 (GRCm39) missense probably damaging 1.00
R6755:Isg20l2 UTSW 3 87,838,996 (GRCm39) missense probably benign 0.21
R7459:Isg20l2 UTSW 3 87,839,485 (GRCm39) missense possibly damaging 0.76
R9036:Isg20l2 UTSW 3 87,839,302 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGTGAGCCATTCTTCCCAG -3'
(R):5'- GCACTCTGAAACTCCCCTAG -3'

Sequencing Primer
(F):5'- CTCCTGAATTTAGACTTTGGGCAAC -3'
(R):5'- TCCCCTAGCAAATCTATTTTAGACAC -3'
Posted On 2022-03-25