Mutagenetix > Incidental Mutations

Incidental Mutation 'R9285:Eml2'

703858

Institutional Source

Beutler Lab

Gene Symbol

Eml2

Ensembl Gene

ENSMUSG00000040811

Gene Name

echinoderm microtubule associated protein like 2

Synonyms

1600029N02Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9285 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19176421-19206482 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19191643 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 222 (I222M)

Ref Sequence

ENSEMBL: ENSMUSP00000112447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]

AlphaFold

Q7TNG5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048502
AA Change: I241M

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: I241M

Domain	Start	End	E-Value	Type
Pfam:HELP	17	65	4.6e-14	PFAM
WD40	113	162	8.36e-2	SMART
WD40	165	210	9.21e0	SMART
WD40	213	252	7.99e-1	SMART
WD40	258	298	3.7e0	SMART
WD40	301	341	3.58e-1	SMART
WD40	385	424	5.52e-2	SMART
WD40	427	465	1.1e1	SMART
WD40	468	507	4.95e-4	SMART
WD40	514	553	4.62e-4	SMART
WD40	579	620	4.75e1	SMART
WD40	626	666	2.67e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117338
AA Change: I414M

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: I414M

Domain	Start	End	E-Value	Type
low complexity region	2	32	N/A	INTRINSIC
coiled coil region	59	106	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
Pfam:HELP	211	285	3.5e-29	PFAM
WD40	286	335	5.5e-4	SMART
WD40	338	383	5.8e-2	SMART
WD40	386	425	5.2e-3	SMART
WD40	431	471	2.4e-2	SMART
WD40	474	514	2.3e-3	SMART
WD40	558	597	3.6e-4	SMART
WD40	600	638	7.1e-2	SMART
WD40	641	680	3.1e-6	SMART
WD40	687	726	3.1e-6	SMART
WD40	752	793	3e-1	SMART
WD40	799	839	1.7e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120595
AA Change: I222M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: I222M

Domain	Start	End	E-Value	Type
WD40	94	154	2.48e0	SMART
WD40	157	196	7.99e-1	SMART
WD40	202	242	3.7e0	SMART
WD40	245	285	3.58e-1	SMART
WD40	329	368	5.52e-2	SMART
WD40	371	409	1.1e1	SMART
WD40	412	451	4.95e-4	SMART
WD40	458	497	4.62e-4	SMART
WD40	523	564	4.75e1	SMART
WD40	570	610	2.67e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000148246
AA Change: I222M

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811
AA Change: I222M

Domain	Start	End	E-Value	Type
WD40	94	143	8.36e-2	SMART
WD40	146	191	9.21e0	SMART
WD40	194	233	7.99e-1	SMART
WD40	239	279	3.7e0	SMART
WD40	282	322	3.58e-1	SMART
WD40	366	405	5.52e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	G	T	6: 128,549,793	T1085K	probably benign	Het
Asxl3	A	T	18: 22,521,932	I1000F	probably damaging	Het
Atp2c2	A	G	8: 119,738,402	M308V	probably benign	Het
Chd3	G	T	11: 69,359,128	R736S	possibly damaging	Het
Chst9	T	A	18: 15,452,960	H182L	probably damaging	Het
Cnot1	A	G	8: 95,726,118	F2112S	probably damaging	Het
Csmd1	A	T	8: 15,906,088	L3373H	probably damaging	Het
Ctsll3	T	A	13: 60,798,588	D303V	probably benign	Het
Cyp7b1	T	A	3: 18,097,400	K216N	probably damaging	Het
Dock9	A	C	14: 121,595,600	F1315V	probably benign	Het
Ggcx	T	A	6: 72,418,419	Y164*	probably null	Het
Gm20939	T	C	17: 94,876,760	F279L	probably damaging	Het
Gprin1	A	G	13: 54,738,710	S584P	probably damaging	Het
Ighv2-2	A	T	12: 113,588,283	Y112N	probably damaging	Het
Kcnu1	T	A	8: 25,891,583	I449K	probably damaging	Het
Lima1	T	C	15: 99,780,806	R585G	probably damaging	Het
Lrrk2	T	A	15: 91,778,483	V1905E	probably damaging	Het
Map3k6	T	A	4: 133,245,559	V343E	probably damaging	Het
Mei1	T	C	15: 82,100,969	F279S		Het
Mgat3	A	G	15: 80,212,337	D455G	probably damaging	Het
Mycbp2	T	A	14: 103,197,317	Q2230L	probably damaging	Het
Myog	T	C	1: 134,291,157	F179S	possibly damaging	Het
Nlrc5	A	C	8: 94,472,976	I72L	probably damaging	Het
Olfr1193	T	A	2: 88,678,336	H153Q	probably damaging	Het
Olfr178	T	A	16: 58,890,206	K5*	probably null	Het
Olfr467	C	T	7: 107,814,614	T10I	probably damaging	Het
Olfr705	T	C	7: 106,873,508	T246A	probably benign	Het
Olfr730	A	C	14: 50,186,665	V185G	probably benign	Het
Pcdh18	A	G	3: 49,753,337	L895P	probably damaging	Het
Pibf1	C	T	14: 99,242,909	T707M	probably benign	Het
Ptk2b	A	T	14: 66,173,395	Y418N	possibly damaging	Het
Ptx4	T	G	17: 25,124,956	Y393*	probably null	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sh2b1	GCTCAGCCACGGGGACCA	GCTCAGCCACGGGGACCAACTCAGCCACGGGGACCA	7: 126,467,579		probably benign	Het
Sh2b1	ACCAGCTC	ACCAGCTCAGCCACGGGGGCCAGCTC	7: 126,467,593		probably benign	Het
Spatc1l	T	C	10: 76,562,430	V22A	probably damaging	Het
Strc	T	C	2: 121,364,798	E1668G	probably damaging	Het
Sulf2	T	A	2: 166,093,515	H226L	probably damaging	Het
Svep1	C	T	4: 58,084,809		probably null	Het
Xylt2	A	T	11: 94,667,710	I540N	probably benign	Het
Zfp804b	T	C	5: 6,770,723	N780S	probably benign	Het
Zfp983	T	A	17: 21,657,604	M8K	possibly damaging	Het

Other mutations in Eml2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00690:Eml2	APN	7	19206143	missense	probably damaging	1.00
IGL00786:Eml2	APN	7	19202582	missense	probably damaging	1.00
IGL01084:Eml2	APN	7	19190738	nonsense	probably null
IGL01132:Eml2	APN	7	19200539	missense	probably damaging	1.00
IGL01678:Eml2	APN	7	19186122	missense	probably benign	0.38
IGL01800:Eml2	APN	7	19201197	intron	probably benign
IGL02517:Eml2	APN	7	19206130	missense	probably damaging	1.00
IGL02607:Eml2	APN	7	19206111	missense	probably damaging	1.00
IGL02676:Eml2	APN	7	19184921	nonsense	probably null
IGL03082:Eml2	APN	7	19201877	missense	probably damaging	1.00
puffery	UTSW	7	19201163	missense	probably damaging	1.00
R0628_Eml2_697	UTSW	7	19201554	splice site	probably benign
R0040:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R0135:Eml2	UTSW	7	19203952	missense	probably damaging	1.00
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0362:Eml2	UTSW	7	19190806	splice site	probably null
R0387:Eml2	UTSW	7	19182259	splice site	probably null
R0432:Eml2	UTSW	7	19179531	nonsense	probably null
R0614:Eml2	UTSW	7	19202591	missense	probably damaging	1.00
R0628:Eml2	UTSW	7	19201554	splice site	probably benign
R1078:Eml2	UTSW	7	19179762	missense	probably benign	0.24
R1531:Eml2	UTSW	7	19196254	missense	probably damaging	1.00
R1856:Eml2	UTSW	7	19194061	missense	probably damaging	0.97
R1864:Eml2	UTSW	7	19201878	missense	probably damaging	1.00
R1937:Eml2	UTSW	7	19203964	missense	possibly damaging	0.68
R2032:Eml2	UTSW	7	19202555	missense	probably benign	0.03
R2185:Eml2	UTSW	7	19194028	missense	probably damaging	1.00
R2419:Eml2	UTSW	7	19176695	unclassified	probably benign
R3821:Eml2	UTSW	7	19202986	missense	possibly damaging	0.94
R4199:Eml2	UTSW	7	19179439	missense	probably benign	0.00
R4411:Eml2	UTSW	7	19182401	critical splice donor site	probably null
R4497:Eml2	UTSW	7	19179350	missense	probably damaging	1.00
R4885:Eml2	UTSW	7	19204010	missense	probably benign	0.05
R4912:Eml2	UTSW	7	19193999	splice site	probably null
R5028:Eml2	UTSW	7	19179447	critical splice donor site	probably null
R5192:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5196:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5373:Eml2	UTSW	7	19179263	missense	possibly damaging	0.92
R5718:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5719:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5720:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5727:Eml2	UTSW	7	19190760	missense	probably damaging	0.99
R5841:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5842:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5843:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5844:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6014:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6015:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6017:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6073:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6075:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6126:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6128:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6129:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6189:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6190:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6258:Eml2	UTSW	7	19179364	splice site	probably null
R6273:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6289:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6376:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6378:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6381:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6384:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6394:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6435:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6436:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6437:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6476:Eml2	UTSW	7	19196311	missense	probably benign	0.26
R6550:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6551:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6552:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6554:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6572:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R6598:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6599:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6704:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6705:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6709:Eml2	UTSW	7	19206211	makesense	probably null
R6730:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6734:Eml2	UTSW	7	19200507	missense	probably benign	0.35
R6742:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6769:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6770:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6864:Eml2	UTSW	7	19196281	missense	probably damaging	0.99
R6878:Eml2	UTSW	7	19200612	missense	probably benign	0.08
R7045:Eml2	UTSW	7	19201579	missense	probably damaging	1.00
R7260:Eml2	UTSW	7	19200590	missense	probably benign	0.45
R7478:Eml2	UTSW	7	19206141	nonsense	probably null
R7706:Eml2	UTSW	7	19186110	missense	possibly damaging	0.79
R7811:Eml2	UTSW	7	19186122	missense	probably benign	0.38
R8084:Eml2	UTSW	7	19181224	critical splice donor site	probably null
R8337:Eml2	UTSW	7	19196236	missense	possibly damaging	0.84
R8414:Eml2	UTSW	7	19179295	missense	probably damaging	1.00
R8868:Eml2	UTSW	7	19194063	missense	probably benign	0.03
R8934:Eml2	UTSW	7	19179813	missense	probably damaging	0.99
R9110:Eml2	UTSW	7	19191695	missense	probably benign	0.07
R9131:Eml2	UTSW	7	19184826	missense
R9144:Eml2	UTSW	7	19201639	missense	possibly damaging	0.75
R9261:Eml2	UTSW	7	19179818	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- TTGTGAACTTGATCCTGGACAC -3'
(R):5'- GGCATTAACAGCTCGGTATTGAC -3'

Sequencing Primer
(F):5'- AATGGACCTTAGTATCTCCCAGTGG -3'
(R):5'- GGTATTGACATACCCCCAAAGC -3'

Posted On

2022-03-25