Incidental Mutation 'R9285:Atp2c2'
ID 703868
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9285 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120465141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 308 (M308V)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]
AlphaFold A7L9Z8
Predicted Effect probably benign
Transcript: ENSMUST00000095171
AA Change: M308V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: M308V

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212454
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G T 6: 128,526,756 (GRCm39) T1085K probably benign Het
Asxl3 A T 18: 22,654,989 (GRCm39) I1000F probably damaging Het
Chd3 G T 11: 69,249,954 (GRCm39) R736S possibly damaging Het
Chst9 T A 18: 15,586,017 (GRCm39) H182L probably damaging Het
Cnot1 A G 8: 96,452,746 (GRCm39) F2112S probably damaging Het
Csmd1 A T 8: 15,956,088 (GRCm39) L3373H probably damaging Het
Ctsll3 T A 13: 60,946,402 (GRCm39) D303V probably benign Het
Cyp7b1 T A 3: 18,151,564 (GRCm39) K216N probably damaging Het
Dock9 A C 14: 121,833,012 (GRCm39) F1315V probably benign Het
Eme2 T C 17: 25,108,132 (GRCm39) probably benign Het
Eml2 A G 7: 18,925,568 (GRCm39) I222M probably damaging Het
Ggcx T A 6: 72,395,402 (GRCm39) Y164* probably null Het
Gm20939 T C 17: 95,184,188 (GRCm39) F279L probably damaging Het
Gm44511 T C 6: 128,777,017 (GRCm39) probably benign Het
Gprin1 A G 13: 54,886,523 (GRCm39) S584P probably damaging Het
Ighv2-2 A T 12: 113,551,903 (GRCm39) Y112N probably damaging Het
Kansl3 T C 1: 36,383,148 (GRCm39) probably benign Het
Kcnu1 T A 8: 26,381,611 (GRCm39) I449K probably damaging Het
Lima1 T C 15: 99,678,687 (GRCm39) R585G probably damaging Het
Lrrk2 T A 15: 91,662,686 (GRCm39) V1905E probably damaging Het
Map3k6 T A 4: 132,972,870 (GRCm39) V343E probably damaging Het
Mei1 T C 15: 81,985,170 (GRCm39) F279S Het
Mgat3 A G 15: 80,096,538 (GRCm39) D455G probably damaging Het
Mycbp2 T A 14: 103,434,753 (GRCm39) Q2230L probably damaging Het
Myog T C 1: 134,218,895 (GRCm39) F179S possibly damaging Het
Nlrc5 A C 8: 95,199,604 (GRCm39) I72L probably damaging Het
Or2ag1 T C 7: 106,472,715 (GRCm39) T246A probably benign Het
Or4k2 A C 14: 50,424,122 (GRCm39) V185G probably benign Het
Or4s2b T A 2: 88,508,680 (GRCm39) H153Q probably damaging Het
Or5k15 T A 16: 58,710,569 (GRCm39) K5* probably null Het
Or5p5 C T 7: 107,413,821 (GRCm39) T10I probably damaging Het
Pcdh18 A G 3: 49,707,786 (GRCm39) L895P probably damaging Het
Pibf1 C T 14: 99,480,345 (GRCm39) T707M probably benign Het
Ptk2b A T 14: 66,410,844 (GRCm39) Y418N possibly damaging Het
Ptx4 T G 17: 25,343,930 (GRCm39) Y393* probably null Het
Sass6 C A 3: 116,422,354 (GRCm39) probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Spatc1l T C 10: 76,398,264 (GRCm39) V22A probably damaging Het
Strc T C 2: 121,195,279 (GRCm39) E1668G probably damaging Het
Sulf2 T A 2: 165,935,435 (GRCm39) H226L probably damaging Het
Sun5 T C 2: 153,709,426 (GRCm39) probably benign Het
Svep1 C T 4: 58,084,809 (GRCm39) probably null Het
Tektl1 C A 10: 78,588,234 (GRCm39) probably benign Het
Xylt2 A T 11: 94,558,536 (GRCm39) I540N probably benign Het
Zfp804b T C 5: 6,820,723 (GRCm39) N780S probably benign Het
Zfp983 T A 17: 21,876,520 (GRCm39) M8K possibly damaging Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGTTCTGGAGACTGGACC -3'
(R):5'- CGGGGTCTCCATGGACTATAC -3'

Sequencing Primer
(F):5'- GCTTCATGCGTACGAGGC -3'
(R):5'- GGGTCTCCATGGACTATACAATGC -3'
Posted On 2022-03-25