Mutagenetix > Incidental Mutation

Incidental Mutation 'R9285:Atp2c2'

703868

Institutional Source

Beutler Lab

Gene Symbol

Atp2c2

Ensembl Gene

ENSMUSG00000034112

Gene Name

ATPase, Ca++ transporting, type 2C, member 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9285 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119700009-119757717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119738402 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 308 (M308V)

Ref Sequence

ENSEMBL: ENSMUSP00000092794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]

AlphaFold

A7L9Z8

Predicted Effect

probably benign
Transcript: ENSMUST00000095171
AA Change: M308V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: M308V

Domain	Start	End	E-Value	Type
Cation_ATPase_N	54	128	1.27e-12	SMART
Pfam:E1-E2_ATPase	133	366	1.7e-62	PFAM
Pfam:Hydrolase	371	684	5.3e-18	PFAM
Pfam:HAD	374	681	7.4e-11	PFAM
Pfam:Cation_ATPase	437	521	1.1e-17	PFAM
Pfam:Cation_ATPase_C	754	927	1.1e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212454

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (49/49)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	G	T	6: 128,549,793	T1085K	probably benign	Het
Asxl3	A	T	18: 22,521,932	I1000F	probably damaging	Het
Ccdc105	C	A	10: 78,752,400		probably benign	Het
Chd3	G	T	11: 69,359,128	R736S	possibly damaging	Het
Chst9	T	A	18: 15,452,960	H182L	probably damaging	Het
Cnot1	A	G	8: 95,726,118	F2112S	probably damaging	Het
Csmd1	A	T	8: 15,906,088	L3373H	probably damaging	Het
Ctsll3	T	A	13: 60,798,588	D303V	probably benign	Het
Cyp7b1	T	A	3: 18,097,400	K216N	probably damaging	Het
Dock9	A	C	14: 121,595,600	F1315V	probably benign	Het
Eme2	T	C	17: 24,889,158		probably benign	Het
Eml2	A	G	7: 19,191,643	I222M	probably damaging	Het
Ggcx	T	A	6: 72,418,419	Y164*	probably null	Het
Gm20939	T	C	17: 94,876,760	F279L	probably damaging	Het
Gm44511	T	C	6: 128,800,054		probably benign	Het
Gprin1	A	G	13: 54,738,710	S584P	probably damaging	Het
Ighv2-2	A	T	12: 113,588,283	Y112N	probably damaging	Het
Kansl3	T	C	1: 36,344,067		probably benign	Het
Kcnu1	T	A	8: 25,891,583	I449K	probably damaging	Het
Lima1	T	C	15: 99,780,806	R585G	probably damaging	Het
Lrrk2	T	A	15: 91,778,483	V1905E	probably damaging	Het
Map3k6	T	A	4: 133,245,559	V343E	probably damaging	Het
Mei1	T	C	15: 82,100,969	F279S		Het
Mgat3	A	G	15: 80,212,337	D455G	probably damaging	Het
Mycbp2	T	A	14: 103,197,317	Q2230L	probably damaging	Het
Myog	T	C	1: 134,291,157	F179S	possibly damaging	Het
Nlrc5	A	C	8: 94,472,976	I72L	probably damaging	Het
Olfr1193	T	A	2: 88,678,336	H153Q	probably damaging	Het
Olfr178	T	A	16: 58,890,206	K5*	probably null	Het
Olfr467	C	T	7: 107,814,614	T10I	probably damaging	Het
Olfr705	T	C	7: 106,873,508	T246A	probably benign	Het
Olfr730	A	C	14: 50,186,665	V185G	probably benign	Het
Pcdh18	A	G	3: 49,753,337	L895P	probably damaging	Het
Pibf1	C	T	14: 99,242,909	T707M	probably benign	Het
Ptk2b	A	T	14: 66,173,395	Y418N	possibly damaging	Het
Ptx4	T	G	17: 25,124,956	Y393*	probably null	Het
Sass6	C	A	3: 116,628,705		probably benign	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Spatc1l	T	C	10: 76,562,430	V22A	probably damaging	Het
Strc	T	C	2: 121,364,798	E1668G	probably damaging	Het
Sulf2	T	A	2: 166,093,515	H226L	probably damaging	Het
Sun5	T	C	2: 153,867,506		probably benign	Het
Svep1	C	T	4: 58,084,809		probably null	Het
Xylt2	A	T	11: 94,667,710	I540N	probably benign	Het
Zfp804b	T	C	5: 6,770,723	N780S	probably benign	Het
Zfp983	T	A	17: 21,657,604	M8K	possibly damaging	Het

Other mutations in Atp2c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Atp2c2	APN	8	119745590	missense	probably benign
IGL01624:Atp2c2	APN	8	119757450	missense	probably benign	0.00
IGL02133:Atp2c2	APN	8	119754335	missense	probably benign	0.00
IGL02221:Atp2c2	APN	8	119744334	missense	probably damaging	1.00
IGL02606:Atp2c2	APN	8	119730274	missense	probably benign
IGL02657:Atp2c2	APN	8	119753032	missense	probably damaging	1.00
IGL02839:Atp2c2	APN	8	119749120	missense	possibly damaging	0.85
IGL03122:Atp2c2	APN	8	119742675	missense	possibly damaging	0.77
R0031:Atp2c2	UTSW	8	119749062	missense	probably benign	0.15
R0372:Atp2c2	UTSW	8	119757441	missense	probably benign
R0502:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0503:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0584:Atp2c2	UTSW	8	119738418	missense	probably benign	0.01
R1225:Atp2c2	UTSW	8	119735245	missense	probably damaging	1.00
R1580:Atp2c2	UTSW	8	119752987	missense	probably benign	0.00
R1620:Atp2c2	UTSW	8	119749126	missense	probably benign
R1638:Atp2c2	UTSW	8	119756003	missense	possibly damaging	0.82
R1745:Atp2c2	UTSW	8	119725094	missense	probably benign	0.02
R1746:Atp2c2	UTSW	8	119734443	unclassified	probably benign
R1907:Atp2c2	UTSW	8	119749876	splice site	probably benign
R2104:Atp2c2	UTSW	8	119749845	missense	probably benign
R2151:Atp2c2	UTSW	8	119756102	missense	probably benign
R2152:Atp2c2	UTSW	8	119756102	missense	probably benign
R2154:Atp2c2	UTSW	8	119756102	missense	probably benign
R2207:Atp2c2	UTSW	8	119748309	missense	probably damaging	1.00
R3874:Atp2c2	UTSW	8	119735296	missense	possibly damaging	0.74
R3912:Atp2c2	UTSW	8	119721276	missense	probably damaging	1.00
R4093:Atp2c2	UTSW	8	119749871	critical splice donor site	probably null
R4782:Atp2c2	UTSW	8	119749152	missense	probably damaging	0.97
R4801:Atp2c2	UTSW	8	119747687	missense	probably damaging	1.00
R4973:Atp2c2	UTSW	8	119754263	missense	probably benign	0.00
R5485:Atp2c2	UTSW	8	119753062	critical splice donor site	probably null
R5978:Atp2c2	UTSW	8	119749875	splice site	probably null
R6377:Atp2c2	UTSW	8	119726354	missense	probably benign	0.10
R6613:Atp2c2	UTSW	8	119756021	missense	probably damaging	0.99
R6765:Atp2c2	UTSW	8	119753017	missense	probably damaging	1.00
R6836:Atp2c2	UTSW	8	119734415	missense	probably damaging	1.00
R6963:Atp2c2	UTSW	8	119730267	nonsense	probably null
R7220:Atp2c2	UTSW	8	119745561	missense	probably benign	0.00
R7238:Atp2c2	UTSW	8	119742421	missense	possibly damaging	0.73
R7373:Atp2c2	UTSW	8	119730252	missense	probably benign	0.02
R7438:Atp2c2	UTSW	8	119748197	missense	probably damaging	1.00
R7573:Atp2c2	UTSW	8	119751269	missense	probably damaging	1.00
R7677:Atp2c2	UTSW	8	119748176	missense	probably benign	0.00
R7737:Atp2c2	UTSW	8	119742395	missense	probably damaging	1.00
R7912:Atp2c2	UTSW	8	119730178	missense	possibly damaging	0.81
R8821:Atp2c2	UTSW	8	119749294	splice site	probably null
R8831:Atp2c2	UTSW	8	119749294	splice site	probably null
R9200:Atp2c2	UTSW	8	119748260	nonsense	probably null
R9211:Atp2c2	UTSW	8	119719293	missense	probably benign
R9246:Atp2c2	UTSW	8	119730250	missense	probably damaging	1.00
RF004:Atp2c2	UTSW	8	119752822	missense	probably damaging	1.00
RF012:Atp2c2	UTSW	8	119745514	missense	possibly damaging	0.91
Z1177:Atp2c2	UTSW	8	119734385	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCAGTTCTGGAGACTGGACC -3'
(R):5'- CGGGGTCTCCATGGACTATAC -3'

Sequencing Primer
(F):5'- GCTTCATGCGTACGAGGC -3'
(R):5'- GGGTCTCCATGGACTATACAATGC -3'

Posted On

2022-03-25