Incidental Mutation 'R0755:Cntrl'
ID70388
Institutional Source Beutler Lab
Gene Symbol Cntrl
Ensembl Gene ENSMUSG00000057110
Gene Namecentriolin
Synonyms6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1
MMRRC Submission 038935-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock #R0755 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35109492-35178822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35145139 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 373 (S373N)
Ref Sequence ENSEMBL: ENSMUSP00000108660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113033] [ENSMUST00000113034] [ENSMUST00000113037] [ENSMUST00000156933] [ENSMUST00000201787]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028237
AA Change: S926N

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: S926N

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 8e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.95e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.95e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113032
AA Change: S926N

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: S926N

DomainStartEndE-ValueType
low complexity region 20 53 N/A INTRINSIC
coiled coil region 72 381 N/A INTRINSIC
coiled coil region 413 907 N/A INTRINSIC
low complexity region 945 960 N/A INTRINSIC
coiled coil region 989 1011 N/A INTRINSIC
low complexity region 1041 1059 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113033
AA Change: S373N

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108656
Gene: ENSMUSG00000057110
AA Change: S373N

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113034
AA Change: S373N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108657
Gene: ENSMUSG00000057110
AA Change: S373N

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.68e-5 PROSPERO
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
coiled coil region 445 549 N/A INTRINSIC
internal_repeat_1 566 579 1.52e-6 PROSPERO
internal_repeat_2 568 596 2.75e-5 PROSPERO
low complexity region 600 608 N/A INTRINSIC
internal_repeat_2 626 653 2.75e-5 PROSPERO
low complexity region 715 748 N/A INTRINSIC
coiled coil region 767 1076 N/A INTRINSIC
internal_repeat_3 1095 1112 5.68e-5 PROSPERO
low complexity region 1184 1224 N/A INTRINSIC
low complexity region 1344 1356 N/A INTRINSIC
low complexity region 1366 1388 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1421 1432 N/A INTRINSIC
low complexity region 1640 1655 N/A INTRINSIC
internal_repeat_1 1699 1712 1.52e-6 PROSPERO
low complexity region 1736 1754 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113037
AA Change: S373N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110
AA Change: S373N

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.34e-5 PROSPERO
coiled coil region 305 548 N/A INTRINSIC
internal_repeat_1 565 578 1.42e-6 PROSPERO
internal_repeat_2 567 595 2.58e-5 PROSPERO
low complexity region 599 607 N/A INTRINSIC
internal_repeat_2 625 652 2.58e-5 PROSPERO
low complexity region 714 747 N/A INTRINSIC
coiled coil region 766 1075 N/A INTRINSIC
internal_repeat_3 1094 1111 5.34e-5 PROSPERO
low complexity region 1183 1223 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1365 1387 N/A INTRINSIC
low complexity region 1399 1414 N/A INTRINSIC
low complexity region 1420 1431 N/A INTRINSIC
low complexity region 1639 1654 N/A INTRINSIC
internal_repeat_1 1698 1711 1.42e-6 PROSPERO
low complexity region 1735 1753 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123884
AA Change: S526N
SMART Domains Protein: ENSMUSP00000119760
Gene: ENSMUSG00000057110
AA Change: S526N

DomainStartEndE-ValueType
coiled coil region 37 400 N/A INTRINSIC
coiled coil region 458 571 N/A INTRINSIC
low complexity region 576 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156933
AA Change: S926N

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: S926N

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.65e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.65e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201787
AA Change: S15N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143914
Gene: ENSMUSG00000057110
AA Change: S15N

DomainStartEndE-ValueType
coiled coil region 9 71 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,946,364 S1231P probably damaging Het
A730061H03Rik A T 14: 55,560,181 probably benign Het
Acin1 A G 14: 54,651,835 M1T probably null Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Aldh1a1 A G 19: 20,617,994 M96V probably benign Het
Ankfn1 T A 11: 89,392,087 M245L probably benign Het
Arhgap19 T C 19: 41,781,175 K54E probably damaging Het
Atp1a2 T C 1: 172,289,381 Q223R probably benign Het
Atp8a2 C T 14: 60,009,881 V557I possibly damaging Het
AU041133 A T 10: 82,150,890 K126* probably null Het
Axin1 T A 17: 26,182,506 Y351N possibly damaging Het
Baiap2l1 T C 5: 144,284,557 K176E probably damaging Het
Baz2a C T 10: 128,119,691 T848I possibly damaging Het
Bbs2 A C 8: 94,082,080 V333G probably benign Het
BC051019 G A 7: 109,716,095 Q318* probably null Het
Cdc37 C T 9: 21,139,864 D362N probably damaging Het
Cep170 A T 1: 176,755,753 V1020E probably damaging Het
Chrm4 T C 2: 91,928,402 V385A probably benign Het
Col23a1 G A 11: 51,576,879 G19D probably damaging Het
Cyb5r4 G T 9: 87,029,572 A100S probably damaging Het
Dctn1 C T 6: 83,189,077 P115S probably damaging Het
Dhrs2 C T 14: 55,234,790 T46M probably damaging Het
Disp2 T C 2: 118,789,762 F325S probably benign Het
Dnah11 T G 12: 117,954,829 T3456P possibly damaging Het
Dnah11 C A 12: 118,198,625 V70F probably benign Het
Duoxa1 T A 2: 122,304,680 T195S probably benign Het
Eif2ak1 T A 5: 143,884,924 F353I possibly damaging Het
Esam A G 9: 37,536,702 T211A probably damaging Het
Faf1 A G 4: 109,961,839 N636S probably benign Het
Fbxo25 A G 8: 13,935,219 Y305C probably benign Het
Fchsd1 C T 18: 37,968,750 probably null Het
Fdxacb1 T A 9: 50,771,725 D329E possibly damaging Het
Gm4070 A T 7: 105,896,685 F2387I possibly damaging Het
Hbq1b A T 11: 32,287,104 probably null Het
Hmcn2 T A 2: 31,453,160 V4566E probably damaging Het
Igkv6-29 G A 6: 70,139,069 T5I probably benign Het
Itfg1 A T 8: 85,726,205 D511E possibly damaging Het
Jmjd1c C T 10: 67,096,599 probably benign Het
Kat6b T A 14: 21,637,593 M570K probably damaging Het
Kdm4d T A 9: 14,464,295 K89M probably damaging Het
Krt19 A T 11: 100,142,139 D194E possibly damaging Het
Lamc1 A T 1: 153,247,450 Y665N possibly damaging Het
Lct A T 1: 128,294,135 S1556T possibly damaging Het
Macf1 A G 4: 123,369,926 L4924P probably damaging Het
Mef2c G A 13: 83,656,353 probably null Het
Mff G A 1: 82,750,605 probably null Het
Mycbp2 A T 14: 103,174,794 L2581Q probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nos3 T A 5: 24,367,297 L123M probably damaging Het
Ntn5 C T 7: 45,686,528 P128S probably benign Het
Nudt9 T C 5: 104,065,054 V331A probably damaging Het
Olfr131 A T 17: 38,082,194 Y261* probably null Het
Olfr854 T C 9: 19,567,119 I88M possibly damaging Het
Pcdh7 A T 5: 57,720,322 K406N possibly damaging Het
Pkdrej T A 15: 85,816,135 I1867L probably benign Het
Plppr4 C T 3: 117,322,670 G455R possibly damaging Het
Pramef6 A G 4: 143,897,729 V66A probably damaging Het
Prkag2 G C 5: 24,947,631 S158R probably benign Het
Ptprq T G 10: 107,582,539 T1659P probably benign Het
Rasl12 A G 9: 65,410,959 K202E probably benign Het
Rb1 A C 14: 73,197,213 *922G probably null Het
Rsf1 C T 7: 97,579,967 P22S probably damaging Het
Scn1a T G 2: 66,321,035 T797P probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc22a7 T G 17: 46,438,187 H68P possibly damaging Het
Slc4a2 G A 5: 24,435,577 A652T probably benign Het
Slc5a1 T A 5: 33,133,389 L106M probably benign Het
Slco1c1 C T 6: 141,531,532 P19S probably damaging Het
Snx1 A G 9: 66,098,456 F127S probably damaging Het
Snx31 A T 15: 36,534,430 I199N probably damaging Het
Snx33 T C 9: 56,925,457 I443V possibly damaging Het
Sptbn1 A G 11: 30,139,016 F749L probably damaging Het
Stoml3 T A 3: 53,498,138 Y53* probably null Het
Stxbp2 A G 8: 3,642,019 T554A probably benign Het
Tal1 T C 4: 115,068,376 I214T probably damaging Het
Tas2r137 T A 6: 40,491,410 I58N probably damaging Het
Thap1 A G 8: 26,158,473 Y8C probably damaging Het
Thsd7a A T 6: 12,555,369 L172Q probably damaging Het
Ube3c T A 5: 29,637,742 D735E probably damaging Het
Unc80 G A 1: 66,504,923 D402N probably damaging Het
Upf1 G T 8: 70,334,129 R902S probably benign Het
Urb1 A G 16: 90,774,094 Y1276H probably damaging Het
Urb1 A T 16: 90,779,138 F843L probably benign Het
Vmn1r198 C T 13: 22,355,232 T296I probably benign Het
Vmn1r33 A T 6: 66,611,908 S221T probably damaging Het
Vmn2r103 A G 17: 19,773,568 D69G probably benign Het
Vmn2r14 T G 5: 109,216,360 L563F possibly damaging Het
Vmn2r60 G A 7: 42,195,445 G744D probably damaging Het
Vstm4 T C 14: 32,892,644 V181A probably damaging Het
Wdr60 T C 12: 116,211,792 I922V probably benign Het
Wdr72 G A 9: 74,145,094 V136I probably benign Het
Zfp236 T A 18: 82,620,332 N1388Y probably damaging Het
Zfp53 T A 17: 21,508,577 F291I probably damaging Het
Zfp944 A T 17: 22,339,908 H119Q possibly damaging Het
Other mutations in Cntrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cntrl APN 2 35137814 splice site probably benign
IGL00478:Cntrl APN 2 35160601 missense probably damaging 0.98
IGL01460:Cntrl APN 2 35165844 missense probably benign 0.04
IGL01556:Cntrl APN 2 35173059 missense probably benign 0.19
IGL02155:Cntrl APN 2 35160238 splice site probably benign
IGL02419:Cntrl APN 2 35134043 missense probably damaging 0.97
PIT4480001:Cntrl UTSW 2 35155428 missense probably damaging 0.96
R0179:Cntrl UTSW 2 35167859 missense probably benign 0.00
R0276:Cntrl UTSW 2 35151732 missense possibly damaging 0.62
R0471:Cntrl UTSW 2 35127380 missense probably benign 0.41
R0763:Cntrl UTSW 2 35171066 missense probably benign
R0781:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R0791:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0792:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0801:Cntrl UTSW 2 35175095 splice site probably benign
R1067:Cntrl UTSW 2 35149022 unclassified probably benign
R1110:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R1117:Cntrl UTSW 2 35127973 missense probably damaging 1.00
R1457:Cntrl UTSW 2 35122756 missense probably benign 0.00
R1472:Cntrl UTSW 2 35169317 critical splice donor site probably null
R1522:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R1702:Cntrl UTSW 2 35171836 critical splice acceptor site probably null
R1762:Cntrl UTSW 2 35122806 frame shift probably null
R1785:Cntrl UTSW 2 35122806 frame shift probably null
R1786:Cntrl UTSW 2 35122806 frame shift probably null
R1812:Cntrl UTSW 2 35149469 missense probably damaging 0.97
R1854:Cntrl UTSW 2 35122684 missense probably damaging 1.00
R1863:Cntrl UTSW 2 35118119 missense possibly damaging 0.93
R1868:Cntrl UTSW 2 35129815 missense probably benign 0.03
R1914:Cntrl UTSW 2 35162861 missense probably benign 0.00
R1915:Cntrl UTSW 2 35162861 missense probably benign 0.00
R2049:Cntrl UTSW 2 35122806 frame shift probably null
R2118:Cntrl UTSW 2 35161965 missense probably benign 0.31
R2140:Cntrl UTSW 2 35122806 frame shift probably null
R2142:Cntrl UTSW 2 35122806 frame shift probably null
R2203:Cntrl UTSW 2 35143737 missense possibly damaging 0.84
R2300:Cntrl UTSW 2 35127513 missense probably benign 0.00
R2349:Cntrl UTSW 2 35176251 missense probably benign 0.18
R2374:Cntrl UTSW 2 35153276 missense possibly damaging 0.46
R3429:Cntrl UTSW 2 35145100 missense probably damaging 1.00
R3890:Cntrl UTSW 2 35170480 missense probably benign 0.02
R3911:Cntrl UTSW 2 35120049 missense probably damaging 1.00
R3922:Cntrl UTSW 2 35129739 missense probably damaging 0.98
R4081:Cntrl UTSW 2 35161926 splice site probably benign
R4081:Cntrl UTSW 2 35175125 missense probably damaging 1.00
R4516:Cntrl UTSW 2 35127981 missense probably benign 0.00
R4518:Cntrl UTSW 2 35148974 missense probably damaging 1.00
R4519:Cntrl UTSW 2 35173111 missense probably damaging 1.00
R4646:Cntrl UTSW 2 35149461 missense probably damaging 0.99
R4753:Cntrl UTSW 2 35153439 missense possibly damaging 0.90
R4763:Cntrl UTSW 2 35175551 missense probably damaging 1.00
R4916:Cntrl UTSW 2 35165682 missense probably benign 0.42
R5168:Cntrl UTSW 2 35157655 missense probably damaging 1.00
R5291:Cntrl UTSW 2 35134060 missense probably damaging 1.00
R5356:Cntrl UTSW 2 35148899 nonsense probably null
R5774:Cntrl UTSW 2 35162861 missense probably benign 0.15
R5947:Cntrl UTSW 2 35116679 missense probably damaging 1.00
R6144:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6147:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6214:Cntrl UTSW 2 35129634 missense probably benign 0.10
R6267:Cntrl UTSW 2 35129793 missense probably damaging 1.00
R6332:Cntrl UTSW 2 35128024 missense possibly damaging 0.78
R6445:Cntrl UTSW 2 35162848 missense probably benign 0.05
R6487:Cntrl UTSW 2 35122682 missense possibly damaging 0.89
R6497:Cntrl UTSW 2 35135572 missense possibly damaging 0.66
R6782:Cntrl UTSW 2 35170646 missense possibly damaging 0.75
R6815:Cntrl UTSW 2 35149491 missense probably damaging 1.00
R6853:Cntrl UTSW 2 35129821 missense possibly damaging 0.87
R6858:Cntrl UTSW 2 35162095 critical splice donor site probably null
R6965:Cntrl UTSW 2 35162833 missense probably benign 0.20
R6970:Cntrl UTSW 2 35118137 missense probably benign
R7085:Cntrl UTSW 2 35165792 missense probably benign 0.00
R7150:Cntrl UTSW 2 35165445 critical splice acceptor site probably null
R7213:Cntrl UTSW 2 35135680 missense possibly damaging 0.95
R7221:Cntrl UTSW 2 35151857 missense possibly damaging 0.46
R7389:Cntrl UTSW 2 35127517 missense probably benign 0.01
R7414:Cntrl UTSW 2 35165467 missense probably benign 0.02
R7427:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7428:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7453:Cntrl UTSW 2 35155409 missense possibly damaging 0.89
R7747:Cntrl UTSW 2 35116798 missense probably damaging 1.00
R7753:Cntrl UTSW 2 35111679 missense probably damaging 1.00
R7811:Cntrl UTSW 2 35162861 missense probably benign 0.00
R7882:Cntrl UTSW 2 35170580 missense probably benign 0.41
R7919:Cntrl UTSW 2 35127401 missense probably benign
R8314:Cntrl UTSW 2 35175143 missense probably benign 0.00
R8332:Cntrl UTSW 2 35126025 missense probably damaging 1.00
RF007:Cntrl UTSW 2 35170500 missense probably benign
RF016:Cntrl UTSW 2 35119986 missense probably benign
RF017:Cntrl UTSW 2 35175189 missense probably damaging 0.96
X0024:Cntrl UTSW 2 35147296 missense probably damaging 1.00
X0026:Cntrl UTSW 2 35149516 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35157768 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35165682 missense probably benign 0.08
X0028:Cntrl UTSW 2 35147344 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCTGTGCTAAAGTCCAATGCTGA -3'
(R):5'- TGAGTGTGGGCTCCACCTCTGA -3'

Sequencing Primer
(F):5'- catacacacacaggcacaag -3'
(R):5'- TGACCCTGTCCCCAGGAAG -3'
Posted On2013-09-30