Incidental Mutation 'R0755:Chrm4'
ID70390
Institutional Source Beutler Lab
Gene Symbol Chrm4
Ensembl Gene ENSMUSG00000040495
Gene Namecholinergic receptor, muscarinic 4
SynonymsChrm-4, muscarinic acetylcholine receptor 4
MMRRC Submission 038935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0755 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91927249-91928688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91928402 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 385 (V385A)
Ref Sequence ENSEMBL: ENSMUSP00000040808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000028672] [ENSMUST00000045537] [ENSMUST00000069423] [ENSMUST00000090602] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000111309] [ENSMUST00000128152] [ENSMUST00000142231]
Predicted Effect probably benign
Transcript: ENSMUST00000028667
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028672
SMART Domains Protein: ENSMUSP00000028672
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045537
AA Change: V385A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000040808
Gene: ENSMUSG00000040495
AA Change: V385A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 248 5.7e-7 PFAM
Pfam:7tm_1 48 453 5.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069423
SMART Domains Protein: ENSMUSP00000068413
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090602
SMART Domains Protein: ENSMUSP00000088090
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099709
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111303
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111309
SMART Domains Protein: ENSMUSP00000106941
Gene: ENSMUSG00000027239

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138894
Predicted Effect probably benign
Transcript: ENSMUST00000142231
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, mouse studies link its function to adenylyl cyclase inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show decreased body weight, hyperactivity, abnormalities in carbamylcholine-induced bradycardia and gallbladder contractility, and altered CNS synaptic transmission. Mice homozygous for a different null allele show loss of the anti-cataleptic effect of scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,946,364 S1231P probably damaging Het
A730061H03Rik A T 14: 55,560,181 probably benign Het
Acin1 A G 14: 54,651,835 M1T probably null Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Aldh1a1 A G 19: 20,617,994 M96V probably benign Het
Ankfn1 T A 11: 89,392,087 M245L probably benign Het
Arhgap19 T C 19: 41,781,175 K54E probably damaging Het
Atp1a2 T C 1: 172,289,381 Q223R probably benign Het
Atp8a2 C T 14: 60,009,881 V557I possibly damaging Het
AU041133 A T 10: 82,150,890 K126* probably null Het
Axin1 T A 17: 26,182,506 Y351N possibly damaging Het
Baiap2l1 T C 5: 144,284,557 K176E probably damaging Het
Baz2a C T 10: 128,119,691 T848I possibly damaging Het
Bbs2 A C 8: 94,082,080 V333G probably benign Het
BC051019 G A 7: 109,716,095 Q318* probably null Het
Cdc37 C T 9: 21,139,864 D362N probably damaging Het
Cep170 A T 1: 176,755,753 V1020E probably damaging Het
Cntrl G A 2: 35,145,139 S373N probably damaging Het
Col23a1 G A 11: 51,576,879 G19D probably damaging Het
Cyb5r4 G T 9: 87,029,572 A100S probably damaging Het
Dctn1 C T 6: 83,189,077 P115S probably damaging Het
Dhrs2 C T 14: 55,234,790 T46M probably damaging Het
Disp2 T C 2: 118,789,762 F325S probably benign Het
Dnah11 T G 12: 117,954,829 T3456P possibly damaging Het
Dnah11 C A 12: 118,198,625 V70F probably benign Het
Duoxa1 T A 2: 122,304,680 T195S probably benign Het
Eif2ak1 T A 5: 143,884,924 F353I possibly damaging Het
Esam A G 9: 37,536,702 T211A probably damaging Het
Faf1 A G 4: 109,961,839 N636S probably benign Het
Fbxo25 A G 8: 13,935,219 Y305C probably benign Het
Fchsd1 C T 18: 37,968,750 probably null Het
Fdxacb1 T A 9: 50,771,725 D329E possibly damaging Het
Gm4070 A T 7: 105,896,685 F2387I possibly damaging Het
Hbq1b A T 11: 32,287,104 probably null Het
Hmcn2 T A 2: 31,453,160 V4566E probably damaging Het
Igkv6-29 G A 6: 70,139,069 T5I probably benign Het
Itfg1 A T 8: 85,726,205 D511E possibly damaging Het
Jmjd1c C T 10: 67,096,599 probably benign Het
Kat6b T A 14: 21,637,593 M570K probably damaging Het
Kdm4d T A 9: 14,464,295 K89M probably damaging Het
Krt19 A T 11: 100,142,139 D194E possibly damaging Het
Lamc1 A T 1: 153,247,450 Y665N possibly damaging Het
Lct A T 1: 128,294,135 S1556T possibly damaging Het
Macf1 A G 4: 123,369,926 L4924P probably damaging Het
Mef2c G A 13: 83,656,353 probably null Het
Mff G A 1: 82,750,605 probably null Het
Mycbp2 A T 14: 103,174,794 L2581Q probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nos3 T A 5: 24,367,297 L123M probably damaging Het
Ntn5 C T 7: 45,686,528 P128S probably benign Het
Nudt9 T C 5: 104,065,054 V331A probably damaging Het
Olfr131 A T 17: 38,082,194 Y261* probably null Het
Olfr854 T C 9: 19,567,119 I88M possibly damaging Het
Pcdh7 A T 5: 57,720,322 K406N possibly damaging Het
Pkdrej T A 15: 85,816,135 I1867L probably benign Het
Plppr4 C T 3: 117,322,670 G455R possibly damaging Het
Pramef6 A G 4: 143,897,729 V66A probably damaging Het
Prkag2 G C 5: 24,947,631 S158R probably benign Het
Ptprq T G 10: 107,582,539 T1659P probably benign Het
Rasl12 A G 9: 65,410,959 K202E probably benign Het
Rb1 A C 14: 73,197,213 *922G probably null Het
Rsf1 C T 7: 97,579,967 P22S probably damaging Het
Scn1a T G 2: 66,321,035 T797P probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc22a7 T G 17: 46,438,187 H68P possibly damaging Het
Slc4a2 G A 5: 24,435,577 A652T probably benign Het
Slc5a1 T A 5: 33,133,389 L106M probably benign Het
Slco1c1 C T 6: 141,531,532 P19S probably damaging Het
Snx1 A G 9: 66,098,456 F127S probably damaging Het
Snx31 A T 15: 36,534,430 I199N probably damaging Het
Snx33 T C 9: 56,925,457 I443V possibly damaging Het
Sptbn1 A G 11: 30,139,016 F749L probably damaging Het
Stoml3 T A 3: 53,498,138 Y53* probably null Het
Stxbp2 A G 8: 3,642,019 T554A probably benign Het
Tal1 T C 4: 115,068,376 I214T probably damaging Het
Tas2r137 T A 6: 40,491,410 I58N probably damaging Het
Thap1 A G 8: 26,158,473 Y8C probably damaging Het
Thsd7a A T 6: 12,555,369 L172Q probably damaging Het
Ube3c T A 5: 29,637,742 D735E probably damaging Het
Unc80 G A 1: 66,504,923 D402N probably damaging Het
Upf1 G T 8: 70,334,129 R902S probably benign Het
Urb1 A G 16: 90,774,094 Y1276H probably damaging Het
Urb1 A T 16: 90,779,138 F843L probably benign Het
Vmn1r198 C T 13: 22,355,232 T296I probably benign Het
Vmn1r33 A T 6: 66,611,908 S221T probably damaging Het
Vmn2r103 A G 17: 19,773,568 D69G probably benign Het
Vmn2r14 T G 5: 109,216,360 L563F possibly damaging Het
Vmn2r60 G A 7: 42,195,445 G744D probably damaging Het
Vstm4 T C 14: 32,892,644 V181A probably damaging Het
Wdr60 T C 12: 116,211,792 I922V probably benign Het
Wdr72 G A 9: 74,145,094 V136I probably benign Het
Zfp236 T A 18: 82,620,332 N1388Y probably damaging Het
Zfp53 T A 17: 21,508,577 F291I probably damaging Het
Zfp944 A T 17: 22,339,908 H119Q possibly damaging Het
Other mutations in Chrm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Chrm4 APN 2 91927831 missense probably damaging 1.00
R0437:Chrm4 UTSW 2 91928443 missense possibly damaging 0.89
R1972:Chrm4 UTSW 2 91927493 missense probably benign 0.00
R2233:Chrm4 UTSW 2 91928530 missense probably benign 0.01
R2235:Chrm4 UTSW 2 91928530 missense probably benign 0.01
R2902:Chrm4 UTSW 2 91927957 missense probably benign 0.00
R3115:Chrm4 UTSW 2 91927360 missense probably benign 0.06
R3907:Chrm4 UTSW 2 91927739 missense probably damaging 0.98
R4839:Chrm4 UTSW 2 91927607 missense probably damaging 1.00
R7033:Chrm4 UTSW 2 91928347 missense probably benign 0.01
R7242:Chrm4 UTSW 2 91927250 start codon destroyed probably null 0.86
R7707:Chrm4 UTSW 2 91927354 missense probably benign 0.01
R8066:Chrm4 UTSW 2 91927697 missense probably damaging 1.00
R8076:Chrm4 UTSW 2 91927859 missense probably damaging 1.00
R8293:Chrm4 UTSW 2 91928218 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGACAAGGACACTTCCAATGAG -3'
(R):5'- TCGTGCTGTTGACGTAGCAGAG -3'

Sequencing Primer
(F):5'- TTCCAATGAGTCCAGCTCAGG -3'
(R):5'- GTAGCAGAGCCAGTAGCC -3'
Posted On2013-09-30