Incidental Mutation 'R9287:Optn'
ID 703966
Institutional Source Beutler Lab
Gene Symbol Optn
Ensembl Gene ENSMUSG00000026672
Gene Name optineurin
Synonyms TFIIIA-INTP, 4930441O07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9287 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 5020642-5064051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5031315 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 452 (Q452L)
Ref Sequence ENSEMBL: ENSMUSP00000027986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027986] [ENSMUST00000114996]
AlphaFold Q8K3K8
Predicted Effect probably damaging
Transcript: ENSMUST00000027986
AA Change: Q452L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027986
Gene: ENSMUSG00000026672
AA Change: Q452L

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
PDB:2ZVO|D 424 512 2e-11 PDB
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114996
AA Change: Q452L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110648
Gene: ENSMUSG00000026672
AA Change: Q452L

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
Pfam:CC2-LZ 407 510 3.2e-33 PFAM
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice hypomorphic allele exhibit background sensitive embryonic lethality with surviving mice exhibiting normal immune cell development, T and B cell activation and TNF- or LPS-mediated activation of cells of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,345 D918G possibly damaging Het
9430097D07Rik T A 2: 32,575,166 probably benign Het
Aadacl2 C A 3: 60,025,152 H363N probably damaging Het
Ace3 T G 11: 105,997,420 S319A probably damaging Het
Amer3 C T 1: 34,588,819 P713L possibly damaging Het
Aoah T C 13: 21,002,709 L453P probably damaging Het
Asz1 A T 6: 18,051,291 L463Q possibly damaging Het
Bpifb6 T A 2: 153,904,615 V143D probably damaging Het
C87414 G A 5: 93,638,110 H104Y possibly damaging Het
Cad T A 5: 31,072,656 M1499K possibly damaging Het
Casp9 T A 4: 141,807,160 C294S probably benign Het
Ccdc7b T A 8: 129,163,840 S65T probably benign Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Cfap54 T C 10: 92,969,703 Y1515C possibly damaging Het
Chrm5 A C 2: 112,479,265 F502C probably damaging Het
Cnst A T 1: 179,579,543 T52S possibly damaging Het
Cntn6 T C 6: 104,832,510 I502T possibly damaging Het
Col7a1 G A 9: 108,958,389 V617M unknown Het
Ctsb A G 14: 63,133,426 D29G probably benign Het
Cyp3a44 T A 5: 145,788,392 Q333L possibly damaging Het
Dnajc27 T C 12: 4,096,256 V95A possibly damaging Het
Eea1 T A 10: 95,995,583 Y179N probably damaging Het
Erbb2 T C 11: 98,435,281 M961T probably damaging Het
Fat4 G A 3: 38,891,632 G1558D probably damaging Het
Foxh1 T C 15: 76,668,926 E196G probably damaging Het
Gcc2 T A 10: 58,269,395 L151* probably null Het
Gcdh C T 8: 84,889,684 G294D probably damaging Het
Gcnt3 A T 9: 70,034,411 F292I probably damaging Het
Glod4 T C 11: 76,237,684 S131G probably benign Het
Gpc2 G A 5: 138,274,324 L576F unknown Het
Gphn G A 12: 78,562,872 S330N possibly damaging Het
Heatr5a C T 12: 51,920,477 C872Y probably damaging Het
Hephl1 G A 9: 15,084,479 S449L probably benign Het
Hrasls5 T A 19: 7,619,326 Y159* probably null Het
Hrh2 G T 13: 54,214,339 M111I probably benign Het
Igfn1 A G 1: 135,997,806 V70A probably benign Het
Il2 G A 3: 37,125,839 T23I probably damaging Het
Irak4 A G 15: 94,563,036 T382A possibly damaging Het
Itih2 A G 2: 10,123,486 S135P possibly damaging Het
Kansl3 C T 1: 36,349,416 D457N probably damaging Het
Kcns3 A G 12: 11,091,600 I366T probably damaging Het
Kif26a C A 12: 112,179,285 Y1743* probably null Het
Lama4 A T 10: 39,105,964 I1730F probably damaging Het
Lax1 T C 1: 133,680,193 N270S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp6 A G 6: 134,506,296 V482A probably benign Het
Mc5r C A 18: 68,339,129 D186E probably damaging Het
Mcph1 A T 8: 18,607,277 probably null Het
Mgam A G 6: 40,728,971 probably benign Het
Mmrn1 A C 6: 60,975,955 T407P probably damaging Het
Mrpl1 T C 5: 96,238,947 V265A probably benign Het
Mrpl15 C T 1: 4,776,633 G240D probably damaging Het
Msx1 A T 5: 37,821,451 M240K probably damaging Het
Mtf1 T C 4: 124,831,141 L337P probably damaging Het
Muc5ac T A 7: 141,807,889 C1646S probably damaging Het
Mvb12a C A 8: 71,546,994 T219N probably damaging Het
Myo16 G A 8: 10,476,114 V885M unknown Het
N4bp2 T A 5: 65,803,512 S509T probably benign Het
Nckap1 A G 2: 80,553,406 V144A possibly damaging Het
Nkx2-6 G T 14: 69,174,955 G191C possibly damaging Het
Nmnat2 T C 1: 153,086,392 I126T probably damaging Het
Nrp2 C T 1: 62,795,855 R863W probably damaging Het
Nup188 C T 2: 30,336,714 R1168C probably damaging Het
Oas3 T A 5: 120,754,689 D1091V probably damaging Het
Olfr911-ps1 C T 9: 38,523,786 T18I probably damaging Het
Pcca G A 14: 122,616,766 V157I probably benign Het
Pcdha9 A G 18: 36,999,228 D450G probably benign Het
Phrf1 C G 7: 141,260,142 D1083E probably benign Het
Plcb4 G A 2: 135,987,897 A947T probably benign Het
Ppp1r3g G A 13: 35,968,851 D85N possibly damaging Het
Prom2 A C 2: 127,538,265 V349G probably damaging Het
Prrc2c C T 1: 162,714,274 S382N probably benign Het
Rai14 A T 15: 10,592,118 N230K probably benign Het
Rexo5 A T 7: 119,802,802 K142I probably damaging Het
Rgs22 T C 15: 36,098,263 H484R probably damaging Het
Rims2 C T 15: 39,679,690 A1440V probably damaging Het
Serpinb1a T C 13: 32,842,963 E332G probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,467,578 probably benign Het
Sh2b1 GGACCAGCTC GGACCAGCTCAGCCACGGTGACCAGCTC 7: 126,467,591 probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,467,599 probably benign Het
Slc26a7 C T 4: 14,516,165 G555S possibly damaging Het
Slc4a2 A T 5: 24,434,125 D386V probably damaging Het
Slc6a17 C T 3: 107,477,235 V350M probably damaging Het
Smc2 A G 4: 52,449,361 Y174C probably damaging Het
Smoc2 A G 17: 14,399,424 Y355C probably damaging Het
Smpd1 T A 7: 105,555,235 V107E probably benign Het
Steap4 T G 5: 7,976,683 F215L probably benign Het
Tbc1d1 T A 5: 64,278,021 S501T probably damaging Het
Tec A G 5: 72,768,774 Y312H probably damaging Het
Ticrr C A 7: 79,693,768 T1127K possibly damaging Het
Tlk2 A G 11: 105,256,896 D438G probably benign Het
Tln2 C A 9: 67,370,698 V343L probably benign Het
Tmem156 T A 5: 65,073,805 I241F probably damaging Het
Tmtc1 G T 6: 148,284,892 N559K probably benign Het
Trbv4 A T 6: 41,059,762 I74F probably benign Het
Trmt1l C T 1: 151,453,148 P524S probably damaging Het
Trpa1 A T 1: 14,885,816 C776* probably null Het
Ttc41 T A 10: 86,763,966 S1043R probably benign Het
Ttn A G 2: 76,746,302 L24749S probably damaging Het
Ube2o C T 11: 116,581,116 G100R probably damaging Het
Unc5b T C 10: 60,773,753 E588G possibly damaging Het
Usp43 G T 11: 67,880,096 Q571K probably damaging Het
Vmn1r127 G A 7: 21,319,002 P287L possibly damaging Het
Wasf3 T A 5: 146,461,047 M208K possibly damaging Het
Xab2 A G 8: 3,613,000 F527S possibly damaging Het
Zfp644 T G 5: 106,637,908 N258H possibly damaging Het
Zfp947 A C 17: 22,145,613 F360C probably damaging Het
Other mutations in Optn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Optn APN 2 5033156 missense possibly damaging 0.93
IGL01433:Optn APN 2 5027144 missense probably benign 0.07
IGL01480:Optn APN 2 5046018 missense probably benign 0.01
IGL01863:Optn APN 2 5021487 splice site probably benign
IGL02108:Optn APN 2 5031273 missense possibly damaging 0.91
IGL02150:Optn APN 2 5033152 missense probably damaging 0.97
IGL02623:Optn APN 2 5035022 missense probably damaging 1.00
R0119:Optn UTSW 2 5024115 missense probably damaging 1.00
R0121:Optn UTSW 2 5024115 missense probably damaging 1.00
R0330:Optn UTSW 2 5034255 missense possibly damaging 0.53
R0332:Optn UTSW 2 5024115 missense probably damaging 1.00
R0335:Optn UTSW 2 5024115 missense probably damaging 1.00
R0390:Optn UTSW 2 5046195 missense probably benign
R0437:Optn UTSW 2 5024115 missense probably damaging 1.00
R1710:Optn UTSW 2 5053130 missense possibly damaging 0.90
R2229:Optn UTSW 2 5024117 missense probably damaging 1.00
R3237:Optn UTSW 2 5034203 missense probably damaging 1.00
R3740:Optn UTSW 2 5034198 missense possibly damaging 0.51
R3741:Optn UTSW 2 5034198 missense possibly damaging 0.51
R4667:Optn UTSW 2 5033139 missense probably benign 0.20
R4783:Optn UTSW 2 5054627 missense probably benign
R4965:Optn UTSW 2 5021379 missense probably benign 0.14
R5121:Optn UTSW 2 5046106 missense probably benign 0.25
R6119:Optn UTSW 2 5021323 splice site probably null
R7024:Optn UTSW 2 5052837 splice site probably null
R7167:Optn UTSW 2 5042483 missense probably benign 0.00
R7685:Optn UTSW 2 5054650 missense probably benign 0.01
R8103:Optn UTSW 2 5040202 missense probably damaging 0.97
R8267:Optn UTSW 2 5054651 missense probably benign 0.00
R8844:Optn UTSW 2 5027112 critical splice donor site probably null
R9082:Optn UTSW 2 5054640 missense probably damaging 1.00
R9141:Optn UTSW 2 5054674 missense possibly damaging 0.93
R9238:Optn UTSW 2 5053140 missense probably damaging 1.00
R9260:Optn UTSW 2 5040265 missense probably benign
R9426:Optn UTSW 2 5054674 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATAAGTCTTATACTAGTACCTGGGAG -3'
(R):5'- ACTGGAGCTGACAGTTCTTAAG -3'

Sequencing Primer
(F):5'- TTCAGGTGTGCACAACCATG -3'
(R):5'- GAGCTGACAGTTCTTAAGTGTAAAGC -3'
Posted On 2022-03-25