Incidental Mutation 'R9287:Il2'
ID 703976
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9287 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 37120523-37125959 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37125839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 23 (T23I)
Ref Sequence ENSEMBL: ENSMUSP00000029275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably damaging
Transcript: ENSMUST00000029275
AA Change: T23I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720
AA Change: T23I

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (109/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,345 D918G possibly damaging Het
9430097D07Rik T A 2: 32,575,166 probably benign Het
Aadacl2 C A 3: 60,025,152 H363N probably damaging Het
Ace3 T G 11: 105,997,420 S319A probably damaging Het
Amer3 C T 1: 34,588,819 P713L possibly damaging Het
Aoah T C 13: 21,002,709 L453P probably damaging Het
Asz1 A T 6: 18,051,291 L463Q possibly damaging Het
Bpifb6 T A 2: 153,904,615 V143D probably damaging Het
C87414 G A 5: 93,638,110 H104Y possibly damaging Het
Cad T A 5: 31,072,656 M1499K possibly damaging Het
Casp9 T A 4: 141,807,160 C294S probably benign Het
Ccdc7b T A 8: 129,163,840 S65T probably benign Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Cfap54 T C 10: 92,969,703 Y1515C possibly damaging Het
Chrm5 A C 2: 112,479,265 F502C probably damaging Het
Cnst A T 1: 179,579,543 T52S possibly damaging Het
Cntn6 T C 6: 104,832,510 I502T possibly damaging Het
Col7a1 G A 9: 108,958,389 V617M unknown Het
Ctsb A G 14: 63,133,426 D29G probably benign Het
Cyp3a44 T A 5: 145,788,392 Q333L possibly damaging Het
Dnajc27 T C 12: 4,096,256 V95A possibly damaging Het
Eea1 T A 10: 95,995,583 Y179N probably damaging Het
Erbb2 T C 11: 98,435,281 M961T probably damaging Het
Fat4 G A 3: 38,891,632 G1558D probably damaging Het
Foxh1 T C 15: 76,668,926 E196G probably damaging Het
Gcc2 T A 10: 58,269,395 L151* probably null Het
Gcdh C T 8: 84,889,684 G294D probably damaging Het
Gcnt3 A T 9: 70,034,411 F292I probably damaging Het
Glod4 T C 11: 76,237,684 S131G probably benign Het
Gpc2 G A 5: 138,274,324 L576F unknown Het
Gphn G A 12: 78,562,872 S330N possibly damaging Het
Heatr5a C T 12: 51,920,477 C872Y probably damaging Het
Hephl1 G A 9: 15,084,479 S449L probably benign Het
Hrasls5 T A 19: 7,619,326 Y159* probably null Het
Hrh2 G T 13: 54,214,339 M111I probably benign Het
Igfn1 A G 1: 135,997,806 V70A probably benign Het
Irak4 A G 15: 94,563,036 T382A possibly damaging Het
Itih2 A G 2: 10,123,486 S135P possibly damaging Het
Kansl3 C T 1: 36,349,416 D457N probably damaging Het
Kcns3 A G 12: 11,091,600 I366T probably damaging Het
Kif26a C A 12: 112,179,285 Y1743* probably null Het
Lama4 A T 10: 39,105,964 I1730F probably damaging Het
Lax1 T C 1: 133,680,193 N270S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp6 A G 6: 134,506,296 V482A probably benign Het
Luzp2 A G 7: 55,264,360 probably benign Het
Mc5r C A 18: 68,339,129 D186E probably damaging Het
Mcph1 A T 8: 18,607,277 probably null Het
Mgam A G 6: 40,728,971 probably benign Het
Mmrn1 A C 6: 60,975,955 T407P probably damaging Het
Mrpl1 T C 5: 96,238,947 V265A probably benign Het
Mrpl15 C T 1: 4,776,633 G240D probably damaging Het
Msx1 A T 5: 37,821,451 M240K probably damaging Het
Mtf1 T C 4: 124,831,141 L337P probably damaging Het
Muc5ac T A 7: 141,807,889 C1646S probably damaging Het
Mvb12a C A 8: 71,546,994 T219N probably damaging Het
Myo16 G A 8: 10,476,114 V885M unknown Het
N4bp2 T A 5: 65,803,512 S509T probably benign Het
Nckap1 A G 2: 80,553,406 V144A possibly damaging Het
Nkx2-6 G T 14: 69,174,955 G191C possibly damaging Het
Nmnat2 T C 1: 153,086,392 I126T probably damaging Het
Nrp2 C T 1: 62,795,855 R863W probably damaging Het
Nup188 C T 2: 30,336,714 R1168C probably damaging Het
Oas3 T A 5: 120,754,689 D1091V probably damaging Het
Olfr911-ps1 C T 9: 38,523,786 T18I probably damaging Het
Optn T A 2: 5,031,315 Q452L probably damaging Het
Pcca G A 14: 122,616,766 V157I probably benign Het
Pcdha9 A G 18: 36,999,228 D450G probably benign Het
Pcnx T A 12: 81,995,549 S38T probably benign Het
Phrf1 C G 7: 141,260,142 D1083E probably benign Het
Plcb4 G A 2: 135,987,897 A947T probably benign Het
Ppp1r3g G A 13: 35,968,851 D85N possibly damaging Het
Prom2 A C 2: 127,538,265 V349G probably damaging Het
Prrc2c C T 1: 162,714,274 S382N probably benign Het
Rai14 A T 15: 10,592,118 N230K probably benign Het
Rexo5 A T 7: 119,802,802 K142I probably damaging Het
Rgs22 T C 15: 36,098,263 H484R probably damaging Het
Rims2 C T 15: 39,679,690 A1440V probably damaging Het
Serpinb1a T C 13: 32,842,963 E332G probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Slc26a7 C T 4: 14,516,165 G555S possibly damaging Het
Slc4a2 A T 5: 24,434,125 D386V probably damaging Het
Slc6a17 C T 3: 107,477,235 V350M probably damaging Het
Smc2 A G 4: 52,449,361 Y174C probably damaging Het
Smoc2 A G 17: 14,399,424 Y355C probably damaging Het
Smpd1 T A 7: 105,555,235 V107E probably benign Het
Snapc1 T C 12: 73,971,999 probably benign Het
Steap4 T G 5: 7,976,683 F215L probably benign Het
Tbc1d1 T A 5: 64,278,021 S501T probably damaging Het
Tec A G 5: 72,768,774 Y312H probably damaging Het
Ticrr C A 7: 79,693,768 T1127K possibly damaging Het
Tlk2 A G 11: 105,256,896 D438G probably benign Het
Tln2 C A 9: 67,370,698 V343L probably benign Het
Tmem156 T A 5: 65,073,805 I241F probably damaging Het
Tmtc1 G T 6: 148,284,892 N559K probably benign Het
Trbv4 A T 6: 41,059,762 I74F probably benign Het
Trmt1l C T 1: 151,453,148 P524S probably damaging Het
Trpa1 A T 1: 14,885,816 C776* probably null Het
Ttc41 T A 10: 86,763,966 S1043R probably benign Het
Ttn A G 2: 76,746,302 L24749S probably damaging Het
Ube2o C T 11: 116,581,116 G100R probably damaging Het
Unc5b T C 10: 60,773,753 E588G possibly damaging Het
Usp43 G T 11: 67,880,096 Q571K probably damaging Het
Vmn1r127 G A 7: 21,319,002 P287L possibly damaging Het
Wasf3 T A 5: 146,461,047 M208K possibly damaging Het
Xab2 A G 8: 3,613,000 F527S possibly damaging Het
Zfp644 T G 5: 106,637,908 N258H possibly damaging Het
Zfp947 A C 17: 22,145,613 F360C probably damaging Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37123007 missense possibly damaging 0.64
IGL02047:Il2 APN 3 37125851 missense probably benign 0.01
FR4304:Il2 UTSW 3 37125826 unclassified probably benign
FR4737:Il2 UTSW 3 37125764 unclassified probably benign
FR4737:Il2 UTSW 3 37125828 unclassified probably benign
FR4976:Il2 UTSW 3 37125829 unclassified probably benign
R8805:Il2 UTSW 3 37123133 missense possibly damaging 0.78
RF001:Il2 UTSW 3 37125762 unclassified probably benign
RF023:Il2 UTSW 3 37125820 unclassified probably benign
RF029:Il2 UTSW 3 37125827 unclassified probably benign
RF030:Il2 UTSW 3 37125827 unclassified probably benign
RF030:Il2 UTSW 3 37125842 unclassified probably benign
RF033:Il2 UTSW 3 37125764 unclassified probably benign
RF033:Il2 UTSW 3 37125842 unclassified probably benign
RF036:Il2 UTSW 3 37125827 unclassified probably benign
RF038:Il2 UTSW 3 37125821 nonsense probably null
RF039:Il2 UTSW 3 37125842 unclassified probably benign
RF041:Il2 UTSW 3 37125842 unclassified probably benign
RF043:Il2 UTSW 3 37125842 unclassified probably benign
RF051:Il2 UTSW 3 37125841 unclassified probably benign
RF058:Il2 UTSW 3 37125817 unclassified probably benign
RF058:Il2 UTSW 3 37125821 unclassified probably benign
RF061:Il2 UTSW 3 37125841 unclassified probably benign
RF064:Il2 UTSW 3 37125764 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCAAGAAAGCTAAAGGTATTGC -3'
(R):5'- TGCCACACAGGTAGACTCTTTG -3'

Sequencing Primer
(F):5'- CCTATAGATGGGATGGCTGTGCAC -3'
(R):5'- GTAATATGTAAAACATCGTGACACCC -3'
Posted On 2022-03-25