Incidental Mutation 'R9287:N4bp2'
ID 703990
Institutional Source Beutler Lab
Gene Symbol N4bp2
Ensembl Gene ENSMUSG00000037795
Gene Name NEDD4 binding protein 2
Synonyms B3bp, LOC333789, LOC386488
Accession Numbers

Genbank: NM_001024917.1; Ensembl: ENSMUST00000113738

Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R9287 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 65763521-65830108 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65803512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 509 (S509T)
Ref Sequence ENSEMBL: ENSMUSP00000144278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]
AlphaFold F8VQG7
Predicted Effect probably benign
Transcript: ENSMUST00000087264
AA Change: S509T

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: S509T

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.1e-15 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201489
AA Change: S509T

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: S509T

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201615
AA Change: S509T

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795
AA Change: S509T

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.2e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 8e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,345 D918G possibly damaging Het
9430097D07Rik T A 2: 32,575,166 probably benign Het
Aadacl2 C A 3: 60,025,152 H363N probably damaging Het
Ace3 T G 11: 105,997,420 S319A probably damaging Het
Amer3 C T 1: 34,588,819 P713L possibly damaging Het
Aoah T C 13: 21,002,709 L453P probably damaging Het
Asz1 A T 6: 18,051,291 L463Q possibly damaging Het
Bpifb6 T A 2: 153,904,615 V143D probably damaging Het
C87414 G A 5: 93,638,110 H104Y possibly damaging Het
Cad T A 5: 31,072,656 M1499K possibly damaging Het
Casp9 T A 4: 141,807,160 C294S probably benign Het
Ccdc7b T A 8: 129,163,840 S65T probably benign Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Cfap54 T C 10: 92,969,703 Y1515C possibly damaging Het
Chrm5 A C 2: 112,479,265 F502C probably damaging Het
Cnst A T 1: 179,579,543 T52S possibly damaging Het
Cntn6 T C 6: 104,832,510 I502T possibly damaging Het
Col7a1 G A 9: 108,958,389 V617M unknown Het
Ctsb A G 14: 63,133,426 D29G probably benign Het
Cyp3a44 T A 5: 145,788,392 Q333L possibly damaging Het
Dnajc27 T C 12: 4,096,256 V95A possibly damaging Het
Eea1 T A 10: 95,995,583 Y179N probably damaging Het
Erbb2 T C 11: 98,435,281 M961T probably damaging Het
Fat4 G A 3: 38,891,632 G1558D probably damaging Het
Foxh1 T C 15: 76,668,926 E196G probably damaging Het
Gcc2 T A 10: 58,269,395 L151* probably null Het
Gcdh C T 8: 84,889,684 G294D probably damaging Het
Gcnt3 A T 9: 70,034,411 F292I probably damaging Het
Glod4 T C 11: 76,237,684 S131G probably benign Het
Gpc2 G A 5: 138,274,324 L576F unknown Het
Gphn G A 12: 78,562,872 S330N possibly damaging Het
Heatr5a C T 12: 51,920,477 C872Y probably damaging Het
Hephl1 G A 9: 15,084,479 S449L probably benign Het
Hrasls5 T A 19: 7,619,326 Y159* probably null Het
Hrh2 G T 13: 54,214,339 M111I probably benign Het
Igfn1 A G 1: 135,997,806 V70A probably benign Het
Il2 G A 3: 37,125,839 T23I probably damaging Het
Irak4 A G 15: 94,563,036 T382A possibly damaging Het
Itih2 A G 2: 10,123,486 S135P possibly damaging Het
Kansl3 C T 1: 36,349,416 D457N probably damaging Het
Kcns3 A G 12: 11,091,600 I366T probably damaging Het
Kif26a C A 12: 112,179,285 Y1743* probably null Het
Lama4 A T 10: 39,105,964 I1730F probably damaging Het
Lax1 T C 1: 133,680,193 N270S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp6 A G 6: 134,506,296 V482A probably benign Het
Mc5r C A 18: 68,339,129 D186E probably damaging Het
Mcph1 A T 8: 18,607,277 probably null Het
Mgam A G 6: 40,728,971 probably benign Het
Mmrn1 A C 6: 60,975,955 T407P probably damaging Het
Mrpl1 T C 5: 96,238,947 V265A probably benign Het
Mrpl15 C T 1: 4,776,633 G240D probably damaging Het
Msx1 A T 5: 37,821,451 M240K probably damaging Het
Mtf1 T C 4: 124,831,141 L337P probably damaging Het
Muc5ac T A 7: 141,807,889 C1646S probably damaging Het
Mvb12a C A 8: 71,546,994 T219N probably damaging Het
Myo16 G A 8: 10,476,114 V885M unknown Het
Nckap1 A G 2: 80,553,406 V144A possibly damaging Het
Nkx2-6 G T 14: 69,174,955 G191C possibly damaging Het
Nmnat2 T C 1: 153,086,392 I126T probably damaging Het
Nrp2 C T 1: 62,795,855 R863W probably damaging Het
Nup188 C T 2: 30,336,714 R1168C probably damaging Het
Oas3 T A 5: 120,754,689 D1091V probably damaging Het
Olfr911-ps1 C T 9: 38,523,786 T18I probably damaging Het
Optn T A 2: 5,031,315 Q452L probably damaging Het
Pcca G A 14: 122,616,766 V157I probably benign Het
Pcdha9 A G 18: 36,999,228 D450G probably benign Het
Phrf1 C G 7: 141,260,142 D1083E probably benign Het
Plcb4 G A 2: 135,987,897 A947T probably benign Het
Ppp1r3g G A 13: 35,968,851 D85N possibly damaging Het
Prom2 A C 2: 127,538,265 V349G probably damaging Het
Prrc2c C T 1: 162,714,274 S382N probably benign Het
Rai14 A T 15: 10,592,118 N230K probably benign Het
Rexo5 A T 7: 119,802,802 K142I probably damaging Het
Rgs22 T C 15: 36,098,263 H484R probably damaging Het
Rims2 C T 15: 39,679,690 A1440V probably damaging Het
Serpinb1a T C 13: 32,842,963 E332G probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,467,578 probably benign Het
Sh2b1 GGACCAGCTC GGACCAGCTCAGCCACGGTGACCAGCTC 7: 126,467,591 probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,467,599 probably benign Het
Slc26a7 C T 4: 14,516,165 G555S possibly damaging Het
Slc4a2 A T 5: 24,434,125 D386V probably damaging Het
Slc6a17 C T 3: 107,477,235 V350M probably damaging Het
Smc2 A G 4: 52,449,361 Y174C probably damaging Het
Smoc2 A G 17: 14,399,424 Y355C probably damaging Het
Smpd1 T A 7: 105,555,235 V107E probably benign Het
Steap4 T G 5: 7,976,683 F215L probably benign Het
Tbc1d1 T A 5: 64,278,021 S501T probably damaging Het
Tec A G 5: 72,768,774 Y312H probably damaging Het
Ticrr C A 7: 79,693,768 T1127K possibly damaging Het
Tlk2 A G 11: 105,256,896 D438G probably benign Het
Tln2 C A 9: 67,370,698 V343L probably benign Het
Tmem156 T A 5: 65,073,805 I241F probably damaging Het
Tmtc1 G T 6: 148,284,892 N559K probably benign Het
Trbv4 A T 6: 41,059,762 I74F probably benign Het
Trmt1l C T 1: 151,453,148 P524S probably damaging Het
Trpa1 A T 1: 14,885,816 C776* probably null Het
Ttc41 T A 10: 86,763,966 S1043R probably benign Het
Ttn A G 2: 76,746,302 L24749S probably damaging Het
Ube2o C T 11: 116,581,116 G100R probably damaging Het
Unc5b T C 10: 60,773,753 E588G possibly damaging Het
Usp43 G T 11: 67,880,096 Q571K probably damaging Het
Vmn1r127 G A 7: 21,319,002 P287L possibly damaging Het
Wasf3 T A 5: 146,461,047 M208K possibly damaging Het
Xab2 A G 8: 3,613,000 F527S possibly damaging Het
Zfp644 T G 5: 106,637,908 N258H possibly damaging Het
Zfp947 A C 17: 22,145,613 F360C probably damaging Het
Other mutations in N4bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:N4bp2 APN 5 65807524 missense probably damaging 0.96
IGL01503:N4bp2 APN 5 65803547 nonsense probably null 0.00
IGL01621:N4bp2 APN 5 65790924 missense probably damaging 1.00
IGL02109:N4bp2 APN 5 65798134 missense probably damaging 1.00
IGL02286:N4bp2 APN 5 65803552 missense probably damaging 1.00
1mM(1):N4bp2 UTSW 5 65807677 missense probably damaging 1.00
IGL03046:N4bp2 UTSW 5 65790960 missense probably damaging 1.00
R0164:N4bp2 UTSW 5 65803573 splice site probably benign
R0285:N4bp2 UTSW 5 65806559 missense probably benign 0.00
R0366:N4bp2 UTSW 5 65806396 missense possibly damaging 0.95
R0548:N4bp2 UTSW 5 65808153 missense probably benign 0.39
R0551:N4bp2 UTSW 5 65820341 splice site probably null
R0671:N4bp2 UTSW 5 65807437 missense probably damaging 0.99
R1136:N4bp2 UTSW 5 65808472 missense probably damaging 1.00
R1515:N4bp2 UTSW 5 65790498 missense probably benign 0.01
R1597:N4bp2 UTSW 5 65807140 missense probably benign 0.45
R1628:N4bp2 UTSW 5 65803572 splice site probably null
R1722:N4bp2 UTSW 5 65806882 missense probably benign 0.08
R1735:N4bp2 UTSW 5 65808316 missense probably damaging 1.00
R1745:N4bp2 UTSW 5 65790822 missense probably benign 0.12
R1759:N4bp2 UTSW 5 65826613 missense probably damaging 1.00
R1799:N4bp2 UTSW 5 65806825 missense possibly damaging 0.62
R1846:N4bp2 UTSW 5 65808519 missense probably damaging 1.00
R1872:N4bp2 UTSW 5 65794518 splice site probably benign
R2042:N4bp2 UTSW 5 65826621 missense probably damaging 1.00
R2082:N4bp2 UTSW 5 65807565 missense probably damaging 1.00
R2101:N4bp2 UTSW 5 65790881 missense probably damaging 1.00
R2147:N4bp2 UTSW 5 65809200 missense probably damaging 1.00
R2251:N4bp2 UTSW 5 65806728 missense probably damaging 1.00
R2507:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2508:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2919:N4bp2 UTSW 5 65807098 missense probably benign 0.22
R3086:N4bp2 UTSW 5 65791053 missense probably damaging 1.00
R4092:N4bp2 UTSW 5 65790456 missense probably benign 0.02
R4177:N4bp2 UTSW 5 65798170 splice site probably null
R4718:N4bp2 UTSW 5 65803463 missense probably damaging 1.00
R4859:N4bp2 UTSW 5 65825298 missense probably damaging 1.00
R4863:N4bp2 UTSW 5 65808130 missense probably benign 0.22
R4915:N4bp2 UTSW 5 65803504 missense probably damaging 1.00
R4949:N4bp2 UTSW 5 65821799 splice site probably null
R4978:N4bp2 UTSW 5 65790240 missense probably damaging 1.00
R5029:N4bp2 UTSW 5 65814780 missense probably damaging 1.00
R5079:N4bp2 UTSW 5 65811977 missense probably damaging 1.00
R5097:N4bp2 UTSW 5 65817218 missense probably damaging 1.00
R5158:N4bp2 UTSW 5 65808462 missense probably damaging 0.99
R5228:N4bp2 UTSW 5 65807518 missense probably benign
R5322:N4bp2 UTSW 5 65790457 missense possibly damaging 0.76
R5554:N4bp2 UTSW 5 65808114 missense probably benign 0.44
R5731:N4bp2 UTSW 5 65809157 missense probably damaging 1.00
R5840:N4bp2 UTSW 5 65808094 missense probably damaging 0.99
R6393:N4bp2 UTSW 5 65791001 missense possibly damaging 0.81
R6767:N4bp2 UTSW 5 65817187 missense probably damaging 1.00
R7103:N4bp2 UTSW 5 65806846 missense probably benign 0.01
R7112:N4bp2 UTSW 5 65790707 missense possibly damaging 0.74
R7171:N4bp2 UTSW 5 65808022 missense probably benign 0.00
R7177:N4bp2 UTSW 5 65807548 missense probably damaging 1.00
R7240:N4bp2 UTSW 5 65794545 missense probably damaging 0.96
R7353:N4bp2 UTSW 5 65806371 missense probably benign 0.01
R7450:N4bp2 UTSW 5 65825300 nonsense probably null
R7560:N4bp2 UTSW 5 65791115 missense probably damaging 0.99
R7698:N4bp2 UTSW 5 65808157 missense probably benign 0.00
R7743:N4bp2 UTSW 5 65808459 missense probably damaging 1.00
R7871:N4bp2 UTSW 5 65807103 missense probably benign 0.00
R7981:N4bp2 UTSW 5 65812142 missense probably benign 0.41
R8065:N4bp2 UTSW 5 65807296 missense probably damaging 0.99
R8067:N4bp2 UTSW 5 65807296 missense probably damaging 0.99
R8164:N4bp2 UTSW 5 65809223 missense probably damaging 1.00
R8166:N4bp2 UTSW 5 65820312 missense probably benign 0.39
R8331:N4bp2 UTSW 5 65807600 missense probably damaging 1.00
R8559:N4bp2 UTSW 5 65825285 missense possibly damaging 0.62
R8806:N4bp2 UTSW 5 65808208 missense possibly damaging 0.63
R9369:N4bp2 UTSW 5 65806916 missense probably damaging 0.97
R9460:N4bp2 UTSW 5 65806543 missense probably benign 0.00
R9462:N4bp2 UTSW 5 65790555 missense probably benign 0.02
R9641:N4bp2 UTSW 5 65790692 missense probably benign 0.15
Z1177:N4bp2 UTSW 5 65807637 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTCTCATGAGAAGTGCCAG -3'
(R):5'- GCTGACTTCAGGTGAAACTGATC -3'

Sequencing Primer
(F):5'- TGGCTCTGAGTTCAGTCCCAAG -3'
(R):5'- TTAACCCACCTGTCGTCA -3'
Posted On 2022-03-25