Incidental Mutation 'R9287:Mgam'
ID 704000
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R9287 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 40605765-40746057 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 40705905 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071535
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201148
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202779
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202966
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (109/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T A 2: 32,465,178 (GRCm39) probably benign Het
Aadacl2 C A 3: 59,932,573 (GRCm39) H363N probably damaging Het
Ace3 T G 11: 105,888,246 (GRCm39) S319A probably damaging Het
Amer3 C T 1: 34,627,900 (GRCm39) P713L possibly damaging Het
Aoah T C 13: 21,186,879 (GRCm39) L453P probably damaging Het
Asz1 A T 6: 18,051,290 (GRCm39) L463Q possibly damaging Het
Bpifb6 T A 2: 153,746,535 (GRCm39) V143D probably damaging Het
Cad T A 5: 31,230,000 (GRCm39) M1499K possibly damaging Het
Casp9 T A 4: 141,534,471 (GRCm39) C294S probably benign Het
Ccdc7b T A 8: 129,890,321 (GRCm39) S65T probably benign Het
Cdh23 G A 10: 60,143,306 (GRCm39) A3005V possibly damaging Het
Cfap54 T C 10: 92,805,565 (GRCm39) Y1515C possibly damaging Het
Chrm5 A C 2: 112,309,610 (GRCm39) F502C probably damaging Het
Cnst A T 1: 179,407,108 (GRCm39) T52S possibly damaging Het
Cntn6 T C 6: 104,809,471 (GRCm39) I502T possibly damaging Het
Col7a1 G A 9: 108,787,457 (GRCm39) V617M unknown Het
Ctsb A G 14: 63,370,875 (GRCm39) D29G probably benign Het
Cyp3a44 T A 5: 145,725,202 (GRCm39) Q333L possibly damaging Het
Dnajc27 T C 12: 4,146,256 (GRCm39) V95A possibly damaging Het
Eea1 T A 10: 95,831,445 (GRCm39) Y179N probably damaging Het
Erbb2 T C 11: 98,326,107 (GRCm39) M961T probably damaging Het
Fat4 G A 3: 38,945,781 (GRCm39) G1558D probably damaging Het
Foxh1 T C 15: 76,553,126 (GRCm39) E196G probably damaging Het
Gcc2 T A 10: 58,105,217 (GRCm39) L151* probably null Het
Gcdh C T 8: 85,616,313 (GRCm39) G294D probably damaging Het
Gcnt3 A T 9: 69,941,693 (GRCm39) F292I probably damaging Het
Glod4 T C 11: 76,128,510 (GRCm39) S131G probably benign Het
Gpc2 G A 5: 138,272,586 (GRCm39) L576F unknown Het
Gphn G A 12: 78,609,646 (GRCm39) S330N possibly damaging Het
Heatr5a C T 12: 51,967,260 (GRCm39) C872Y probably damaging Het
Hephl1 G A 9: 14,995,775 (GRCm39) S449L probably benign Het
Hrh2 G T 13: 54,368,358 (GRCm39) M111I probably benign Het
Igfn1 A G 1: 135,925,544 (GRCm39) V70A probably benign Het
Il2 G A 3: 37,179,988 (GRCm39) T23I probably damaging Het
Irak4 A G 15: 94,460,917 (GRCm39) T382A possibly damaging Het
Itih2 A G 2: 10,128,297 (GRCm39) S135P possibly damaging Het
Kansl3 C T 1: 36,388,497 (GRCm39) D457N probably damaging Het
Kcns3 A G 12: 11,141,601 (GRCm39) I366T probably damaging Het
Kif26a C A 12: 112,145,719 (GRCm39) Y1743* probably null Het
Lama4 A T 10: 38,981,960 (GRCm39) I1730F probably damaging Het
Lax1 T C 1: 133,607,931 (GRCm39) N270S probably benign Het
Lrp1 G T 10: 127,403,233 (GRCm39) D2113E probably damaging Het
Lrp6 A G 6: 134,483,259 (GRCm39) V482A probably benign Het
Luzp2 A G 7: 54,914,108 (GRCm39) probably benign Het
Mc5r C A 18: 68,472,200 (GRCm39) D186E probably damaging Het
Mcph1 A T 8: 18,657,293 (GRCm39) probably null Het
Mmrn1 A C 6: 60,952,939 (GRCm39) T407P probably damaging Het
Mrpl1 T C 5: 96,386,806 (GRCm39) V265A probably benign Het
Mrpl15 C T 1: 4,846,856 (GRCm39) G240D probably damaging Het
Msx1 A T 5: 37,978,795 (GRCm39) M240K probably damaging Het
Mtf1 T C 4: 124,724,934 (GRCm39) L337P probably damaging Het
Muc5ac T A 7: 141,361,626 (GRCm39) C1646S probably damaging Het
Mvb12a C A 8: 71,999,638 (GRCm39) T219N probably damaging Het
Myo16 G A 8: 10,526,114 (GRCm39) V885M unknown Het
N4bp2 T A 5: 65,960,855 (GRCm39) S509T probably benign Het
Nckap1 A G 2: 80,383,750 (GRCm39) V144A possibly damaging Het
Nkx2-6 G T 14: 69,412,404 (GRCm39) G191C possibly damaging Het
Nmnat2 T C 1: 152,962,138 (GRCm39) I126T probably damaging Het
Nrp2 C T 1: 62,835,014 (GRCm39) R863W probably damaging Het
Nup188 C T 2: 30,226,726 (GRCm39) R1168C probably damaging Het
Oas3 T A 5: 120,892,754 (GRCm39) D1091V probably damaging Het
Optn T A 2: 5,036,126 (GRCm39) Q452L probably damaging Het
Or8b47 C T 9: 38,435,082 (GRCm39) T18I probably damaging Het
Pcca G A 14: 122,854,178 (GRCm39) V157I probably benign Het
Pcdha9 A G 18: 37,132,281 (GRCm39) D450G probably benign Het
Pcnx1 T A 12: 82,042,323 (GRCm39) S38T probably benign Het
Phrf1 C G 7: 140,840,055 (GRCm39) D1083E probably benign Het
Plaat5 T A 19: 7,596,691 (GRCm39) Y159* probably null Het
Plcb4 G A 2: 135,829,817 (GRCm39) A947T probably benign Het
Ppp1r3g G A 13: 36,152,834 (GRCm39) D85N possibly damaging Het
Pramel34 G A 5: 93,785,969 (GRCm39) H104Y possibly damaging Het
Prom2 A C 2: 127,380,185 (GRCm39) V349G probably damaging Het
Prrc2c C T 1: 162,541,843 (GRCm39) S382N probably benign Het
Rai14 A T 15: 10,592,204 (GRCm39) N230K probably benign Het
Rexo5 A T 7: 119,402,025 (GRCm39) K142I probably damaging Het
Rgs22 T C 15: 36,098,409 (GRCm39) H484R probably damaging Het
Rims2 C T 15: 39,543,086 (GRCm39) A1440V probably damaging Het
Serpinb1a T C 13: 33,026,946 (GRCm39) E332G probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Slc26a7 C T 4: 14,516,165 (GRCm39) G555S possibly damaging Het
Slc4a2 A T 5: 24,639,123 (GRCm39) D386V probably damaging Het
Slc6a17 C T 3: 107,384,551 (GRCm39) V350M probably damaging Het
Smc2 A G 4: 52,449,361 (GRCm39) Y174C probably damaging Het
Smoc2 A G 17: 14,619,686 (GRCm39) Y355C probably damaging Het
Smpd1 T A 7: 105,204,442 (GRCm39) V107E probably benign Het
Snapc1 T C 12: 74,018,773 (GRCm39) probably benign Het
Spata31e2 T C 1: 26,722,426 (GRCm39) D918G possibly damaging Het
Steap4 T G 5: 8,026,683 (GRCm39) F215L probably benign Het
Tbc1d1 T A 5: 64,435,364 (GRCm39) S501T probably damaging Het
Tec A G 5: 72,926,117 (GRCm39) Y312H probably damaging Het
Ticrr C A 7: 79,343,516 (GRCm39) T1127K possibly damaging Het
Tlk2 A G 11: 105,147,722 (GRCm39) D438G probably benign Het
Tln2 C A 9: 67,277,980 (GRCm39) V343L probably benign Het
Tmem156 T A 5: 65,231,148 (GRCm39) I241F probably damaging Het
Tmtc1 G T 6: 148,186,390 (GRCm39) N559K probably benign Het
Trbv4 A T 6: 41,036,696 (GRCm39) I74F probably benign Het
Trmt1l C T 1: 151,328,899 (GRCm39) P524S probably damaging Het
Trpa1 A T 1: 14,956,040 (GRCm39) C776* probably null Het
Ttc41 T A 10: 86,599,830 (GRCm39) S1043R probably benign Het
Ttn A G 2: 76,576,646 (GRCm39) L24749S probably damaging Het
Ube2o C T 11: 116,471,942 (GRCm39) G100R probably damaging Het
Unc5b T C 10: 60,609,532 (GRCm39) E588G possibly damaging Het
Usp43 G T 11: 67,770,922 (GRCm39) Q571K probably damaging Het
Vmn1r127 G A 7: 21,052,927 (GRCm39) P287L possibly damaging Het
Wasf3 T A 5: 146,397,857 (GRCm39) M208K possibly damaging Het
Xab2 A G 8: 3,663,000 (GRCm39) F527S possibly damaging Het
Zfp644 T G 5: 106,785,774 (GRCm39) N258H possibly damaging Het
Zfp947 A C 17: 22,364,594 (GRCm39) F360C probably damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40,619,944 (GRCm39) missense probably benign
IGL01065:Mgam APN 6 40,639,644 (GRCm39) critical splice donor site probably null
IGL01402:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01404:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01413:Mgam APN 6 40,638,211 (GRCm39) missense probably damaging 1.00
IGL01546:Mgam APN 6 40,631,627 (GRCm39) missense probably damaging 0.98
IGL01596:Mgam APN 6 40,635,204 (GRCm39) missense probably damaging 1.00
IGL02133:Mgam APN 6 40,620,010 (GRCm39) missense probably damaging 0.98
IGL02734:Mgam APN 6 40,639,628 (GRCm39) missense probably damaging 1.00
BB002:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
BB012:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R0012:Mgam UTSW 6 40,742,190 (GRCm39) splice site probably null
R0116:Mgam UTSW 6 40,635,921 (GRCm39) missense probably damaging 1.00
R0310:Mgam UTSW 6 40,737,969 (GRCm39) splice site probably benign
R0452:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
R0497:Mgam UTSW 6 40,641,826 (GRCm39) missense probably damaging 1.00
R0699:Mgam UTSW 6 40,619,953 (GRCm39) missense possibly damaging 0.84
R0738:Mgam UTSW 6 40,731,869 (GRCm39) missense probably benign 0.01
R1033:Mgam UTSW 6 40,657,558 (GRCm39) missense probably benign 0.07
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1430:Mgam UTSW 6 40,733,305 (GRCm39) missense probably benign 0.08
R1432:Mgam UTSW 6 40,733,301 (GRCm39) missense probably damaging 1.00
R1443:Mgam UTSW 6 40,736,714 (GRCm39) nonsense probably null
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1519:Mgam UTSW 6 40,638,617 (GRCm39) missense probably benign 0.45
R1654:Mgam UTSW 6 40,734,421 (GRCm39) missense probably damaging 1.00
R1667:Mgam UTSW 6 40,653,978 (GRCm39) missense possibly damaging 0.62
R1730:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1781:Mgam UTSW 6 40,646,797 (GRCm39) missense probably damaging 1.00
R1783:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1829:Mgam UTSW 6 40,643,826 (GRCm39) missense probably damaging 1.00
R1833:Mgam UTSW 6 40,631,652 (GRCm39) critical splice donor site probably null
R1872:Mgam UTSW 6 40,638,234 (GRCm39) nonsense probably null
R1912:Mgam UTSW 6 40,741,119 (GRCm39) nonsense probably null
R1977:Mgam UTSW 6 40,641,814 (GRCm39) missense probably benign 0.01
R2048:Mgam UTSW 6 40,633,363 (GRCm39) missense possibly damaging 0.80
R2086:Mgam UTSW 6 40,737,962 (GRCm39) splice site probably null
R2138:Mgam UTSW 6 40,733,384 (GRCm39) missense probably damaging 1.00
R2224:Mgam UTSW 6 40,741,208 (GRCm39) splice site probably null
R2408:Mgam UTSW 6 40,663,456 (GRCm39) missense probably damaging 1.00
R2508:Mgam UTSW 6 40,736,717 (GRCm39) missense probably damaging 1.00
R2842:Mgam UTSW 6 40,638,279 (GRCm39) missense probably benign 0.01
R2847:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2848:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2965:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R2966:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R3035:Mgam UTSW 6 40,640,464 (GRCm39) missense probably benign
R3895:Mgam UTSW 6 40,736,054 (GRCm39) missense probably damaging 1.00
R4027:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4030:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4302:Mgam UTSW 6 40,740,019 (GRCm39) missense probably benign 0.02
R4707:Mgam UTSW 6 40,691,566 (GRCm39) splice site probably null
R4826:Mgam UTSW 6 40,657,582 (GRCm39) missense possibly damaging 0.52
R4898:Mgam UTSW 6 40,619,988 (GRCm39) missense probably benign
R5438:Mgam UTSW 6 40,661,455 (GRCm39) missense probably damaging 1.00
R5492:Mgam UTSW 6 40,733,297 (GRCm39) missense probably damaging 1.00
R5770:Mgam UTSW 6 40,646,738 (GRCm39) missense probably benign 0.01
R5839:Mgam UTSW 6 40,716,998 (GRCm39) missense possibly damaging 0.90
R5845:Mgam UTSW 6 40,652,257 (GRCm39) missense possibly damaging 0.78
R5847:Mgam UTSW 6 40,660,989 (GRCm39) missense probably benign 0.42
R5891:Mgam UTSW 6 40,721,282 (GRCm39) missense probably benign
R6158:Mgam UTSW 6 40,734,648 (GRCm39) missense probably damaging 1.00
R6193:Mgam UTSW 6 40,724,854 (GRCm39) nonsense probably null
R6423:Mgam UTSW 6 40,653,979 (GRCm39) missense possibly damaging 0.84
R6706:Mgam UTSW 6 40,721,720 (GRCm39) missense probably benign 0.00
R6813:Mgam UTSW 6 40,727,099 (GRCm39) missense probably damaging 0.99
R6863:Mgam UTSW 6 40,705,943 (GRCm39) missense probably benign 0.00
R6906:Mgam UTSW 6 40,724,853 (GRCm39) missense probably damaging 1.00
R7091:Mgam UTSW 6 40,745,210 (GRCm39) missense possibly damaging 0.95
R7099:Mgam UTSW 6 40,638,650 (GRCm39) missense probably benign 0.09
R7282:Mgam UTSW 6 40,740,045 (GRCm39) missense probably benign
R7282:Mgam UTSW 6 40,633,446 (GRCm39) missense possibly damaging 0.71
R7354:Mgam UTSW 6 40,721,732 (GRCm39) missense probably damaging 1.00
R7374:Mgam UTSW 6 40,734,373 (GRCm39) missense possibly damaging 0.89
R7399:Mgam UTSW 6 40,643,788 (GRCm39) missense probably damaging 0.99
R7406:Mgam UTSW 6 40,640,459 (GRCm39) missense probably benign 0.13
R7446:Mgam UTSW 6 40,723,266 (GRCm39) missense probably damaging 1.00
R7466:Mgam UTSW 6 40,721,723 (GRCm39) missense probably benign 0.00
R7525:Mgam UTSW 6 40,742,954 (GRCm39) missense probably benign 0.01
R7530:Mgam UTSW 6 40,686,152 (GRCm39) splice site probably null
R7570:Mgam UTSW 6 40,723,367 (GRCm39) missense probably benign 0.16
R7669:Mgam UTSW 6 40,635,944 (GRCm39) missense probably benign 0.00
R7679:Mgam UTSW 6 40,619,980 (GRCm39) missense probably damaging 0.98
R7746:Mgam UTSW 6 40,645,127 (GRCm39) missense probably damaging 0.99
R7859:Mgam UTSW 6 40,717,113 (GRCm39) missense possibly damaging 0.75
R7925:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R8206:Mgam UTSW 6 40,657,169 (GRCm39) missense probably benign 0.00
R8244:Mgam UTSW 6 40,727,520 (GRCm39) missense probably damaging 1.00
R8309:Mgam UTSW 6 40,722,111 (GRCm39) missense possibly damaging 0.88
R8472:Mgam UTSW 6 40,671,460 (GRCm39) splice site probably null
R8758:Mgam UTSW 6 40,705,977 (GRCm39) missense probably benign 0.41
R8777:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8783:Mgam UTSW 6 40,633,423 (GRCm39) missense probably damaging 0.99
R8939:Mgam UTSW 6 40,740,137 (GRCm39) critical splice donor site probably null
R8968:Mgam UTSW 6 40,734,745 (GRCm39) critical splice acceptor site probably null
R8987:Mgam UTSW 6 40,706,570 (GRCm39) missense probably damaging 1.00
R9055:Mgam UTSW 6 40,691,663 (GRCm39) intron probably benign
R9171:Mgam UTSW 6 40,745,146 (GRCm39) missense possibly damaging 0.76
R9252:Mgam UTSW 6 40,706,577 (GRCm39) missense probably damaging 0.99
R9258:Mgam UTSW 6 40,657,121 (GRCm39) missense probably benign
R9262:Mgam UTSW 6 40,723,422 (GRCm39) critical splice donor site probably null
R9521:Mgam UTSW 6 40,722,118 (GRCm39) missense probably damaging 1.00
R9589:Mgam UTSW 6 40,727,519 (GRCm39) missense probably damaging 1.00
R9658:Mgam UTSW 6 40,721,311 (GRCm39) missense possibly damaging 0.93
R9784:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
RF011:Mgam UTSW 6 40,734,370 (GRCm39) missense probably damaging 1.00
RF020:Mgam UTSW 6 40,662,243 (GRCm39) missense probably damaging 1.00
RF023:Mgam UTSW 6 40,657,642 (GRCm39) missense probably benign
X0021:Mgam UTSW 6 40,635,981 (GRCm39) missense probably damaging 1.00
Z1088:Mgam UTSW 6 40,619,994 (GRCm39) missense probably benign 0.01
Z1176:Mgam UTSW 6 40,706,000 (GRCm39) missense probably damaging 1.00
Z1176:Mgam UTSW 6 40,654,578 (GRCm39) critical splice donor site probably null
Z1177:Mgam UTSW 6 40,717,005 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAATCCATCATTGGTGTGTG -3'
(R):5'- AGAAAGCTGACATCATACCTTGG -3'

Sequencing Primer
(F):5'- TGCTTCTGCAGACAGGGG -3'
(R):5'- GACATCATACCTTGGTCCCAATGG -3'
Posted On 2022-03-25