Mutagenetix > Incidental Mutation

Incidental Mutation 'R9287:Cntn6'

704003

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R9287 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104832510 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 502 (I502T)

Ref Sequence

ENSEMBL: ENSMUSP00000086623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089215
AA Change: I502T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: I502T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161070
AA Change: I430T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: I430T

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162872
AA Change: I502T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: I502T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (109/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	C	1: 26,683,345	D918G	possibly damaging	Het
9430097D07Rik	T	A	2: 32,575,166		probably benign	Het
Aadacl2	C	A	3: 60,025,152	H363N	probably damaging	Het
Ace3	T	G	11: 105,997,420	S319A	probably damaging	Het
Amer3	C	T	1: 34,588,819	P713L	possibly damaging	Het
Aoah	T	C	13: 21,002,709	L453P	probably damaging	Het
Asz1	A	T	6: 18,051,291	L463Q	possibly damaging	Het
Bpifb6	T	A	2: 153,904,615	V143D	probably damaging	Het
C87414	G	A	5: 93,638,110	H104Y	possibly damaging	Het
Cad	T	A	5: 31,072,656	M1499K	possibly damaging	Het
Casp9	T	A	4: 141,807,160	C294S	probably benign	Het
Ccdc7b	T	A	8: 129,163,840	S65T	probably benign	Het
Cdh23	G	A	10: 60,307,527	A3005V	possibly damaging	Het
Cfap54	T	C	10: 92,969,703	Y1515C	possibly damaging	Het
Chrm5	A	C	2: 112,479,265	F502C	probably damaging	Het
Cnst	A	T	1: 179,579,543	T52S	possibly damaging	Het
Col7a1	G	A	9: 108,958,389	V617M	unknown	Het
Ctsb	A	G	14: 63,133,426	D29G	probably benign	Het
Cyp3a44	T	A	5: 145,788,392	Q333L	possibly damaging	Het
Dnajc27	T	C	12: 4,096,256	V95A	possibly damaging	Het
Eea1	T	A	10: 95,995,583	Y179N	probably damaging	Het
Erbb2	T	C	11: 98,435,281	M961T	probably damaging	Het
Fat4	G	A	3: 38,891,632	G1558D	probably damaging	Het
Foxh1	T	C	15: 76,668,926	E196G	probably damaging	Het
Gcc2	T	A	10: 58,269,395	L151*	probably null	Het
Gcdh	C	T	8: 84,889,684	G294D	probably damaging	Het
Gcnt3	A	T	9: 70,034,411	F292I	probably damaging	Het
Glod4	T	C	11: 76,237,684	S131G	probably benign	Het
Gpc2	G	A	5: 138,274,324	L576F	unknown	Het
Gphn	G	A	12: 78,562,872	S330N	possibly damaging	Het
Heatr5a	C	T	12: 51,920,477	C872Y	probably damaging	Het
Hephl1	G	A	9: 15,084,479	S449L	probably benign	Het
Hrasls5	T	A	19: 7,619,326	Y159*	probably null	Het
Hrh2	G	T	13: 54,214,339	M111I	probably benign	Het
Igfn1	A	G	1: 135,997,806	V70A	probably benign	Het
Il2	G	A	3: 37,125,839	T23I	probably damaging	Het
Irak4	A	G	15: 94,563,036	T382A	possibly damaging	Het
Itih2	A	G	2: 10,123,486	S135P	possibly damaging	Het
Kansl3	C	T	1: 36,349,416	D457N	probably damaging	Het
Kcns3	A	G	12: 11,091,600	I366T	probably damaging	Het
Kif26a	C	A	12: 112,179,285	Y1743*	probably null	Het
Lama4	A	T	10: 39,105,964	I1730F	probably damaging	Het
Lax1	T	C	1: 133,680,193	N270S	probably benign	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp6	A	G	6: 134,506,296	V482A	probably benign	Het
Luzp2	A	G	7: 55,264,360		probably benign	Het
Mc5r	C	A	18: 68,339,129	D186E	probably damaging	Het
Mcph1	A	T	8: 18,607,277		probably null	Het
Mgam	A	G	6: 40,728,971		probably benign	Het
Mmrn1	A	C	6: 60,975,955	T407P	probably damaging	Het
Mrpl1	T	C	5: 96,238,947	V265A	probably benign	Het
Mrpl15	C	T	1: 4,776,633	G240D	probably damaging	Het
Msx1	A	T	5: 37,821,451	M240K	probably damaging	Het
Mtf1	T	C	4: 124,831,141	L337P	probably damaging	Het
Muc5ac	T	A	7: 141,807,889	C1646S	probably damaging	Het
Mvb12a	C	A	8: 71,546,994	T219N	probably damaging	Het
Myo16	G	A	8: 10,476,114	V885M	unknown	Het
N4bp2	T	A	5: 65,803,512	S509T	probably benign	Het
Nckap1	A	G	2: 80,553,406	V144A	possibly damaging	Het
Nkx2-6	G	T	14: 69,174,955	G191C	possibly damaging	Het
Nmnat2	T	C	1: 153,086,392	I126T	probably damaging	Het
Nrp2	C	T	1: 62,795,855	R863W	probably damaging	Het
Nup188	C	T	2: 30,336,714	R1168C	probably damaging	Het
Oas3	T	A	5: 120,754,689	D1091V	probably damaging	Het
Olfr911-ps1	C	T	9: 38,523,786	T18I	probably damaging	Het
Optn	T	A	2: 5,031,315	Q452L	probably damaging	Het
Pcca	G	A	14: 122,616,766	V157I	probably benign	Het
Pcdha9	A	G	18: 36,999,228	D450G	probably benign	Het
Pcnx	T	A	12: 81,995,549	S38T	probably benign	Het
Phrf1	C	G	7: 141,260,142	D1083E	probably benign	Het
Plcb4	G	A	2: 135,987,897	A947T	probably benign	Het
Ppp1r3g	G	A	13: 35,968,851	D85N	possibly damaging	Het
Prom2	A	C	2: 127,538,265	V349G	probably damaging	Het
Prrc2c	C	T	1: 162,714,274	S382N	probably benign	Het
Rai14	A	T	15: 10,592,118	N230K	probably benign	Het
Rexo5	A	T	7: 119,802,802	K142I	probably damaging	Het
Rgs22	T	C	15: 36,098,263	H484R	probably damaging	Het
Rims2	C	T	15: 39,679,690	A1440V	probably damaging	Het
Serpinb1a	T	C	13: 32,842,963	E332G	probably damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Slc26a7	C	T	4: 14,516,165	G555S	possibly damaging	Het
Slc4a2	A	T	5: 24,434,125	D386V	probably damaging	Het
Slc6a17	C	T	3: 107,477,235	V350M	probably damaging	Het
Smc2	A	G	4: 52,449,361	Y174C	probably damaging	Het
Smoc2	A	G	17: 14,399,424	Y355C	probably damaging	Het
Smpd1	T	A	7: 105,555,235	V107E	probably benign	Het
Snapc1	T	C	12: 73,971,999		probably benign	Het
Steap4	T	G	5: 7,976,683	F215L	probably benign	Het
Tbc1d1	T	A	5: 64,278,021	S501T	probably damaging	Het
Tec	A	G	5: 72,768,774	Y312H	probably damaging	Het
Ticrr	C	A	7: 79,693,768	T1127K	possibly damaging	Het
Tlk2	A	G	11: 105,256,896	D438G	probably benign	Het
Tln2	C	A	9: 67,370,698	V343L	probably benign	Het
Tmem156	T	A	5: 65,073,805	I241F	probably damaging	Het
Tmtc1	G	T	6: 148,284,892	N559K	probably benign	Het
Trbv4	A	T	6: 41,059,762	I74F	probably benign	Het
Trmt1l	C	T	1: 151,453,148	P524S	probably damaging	Het
Trpa1	A	T	1: 14,885,816	C776*	probably null	Het
Ttc41	T	A	10: 86,763,966	S1043R	probably benign	Het
Ttn	A	G	2: 76,746,302	L24749S	probably damaging	Het
Ube2o	C	T	11: 116,581,116	G100R	probably damaging	Het
Unc5b	T	C	10: 60,773,753	E588G	possibly damaging	Het
Usp43	G	T	11: 67,880,096	Q571K	probably damaging	Het
Vmn1r127	G	A	7: 21,319,002	P287L	possibly damaging	Het
Wasf3	T	A	5: 146,461,047	M208K	possibly damaging	Het
Xab2	A	G	8: 3,613,000	F527S	possibly damaging	Het
Zfp644	T	G	5: 106,637,908	N258H	possibly damaging	Het
Zfp947	A	C	17: 22,145,613	F360C	probably damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTACAGGGGAACACCAG -3'
(R):5'- TAGCAATTTGAGACACTTACTCCCC -3'

Sequencing Primer
(F):5'- ACTTTTGGGATAGCATTGGAAATG -3'
(R):5'- CCAATTCGTTCAAAATGGGCTACTC -3'

Posted On

2022-03-25