Incidental Mutation 'R9287:Cntn6'
ID 704003
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Name contactin 6
Synonyms NB-3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R9287 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 104469751-104840367 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104809471 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 502 (I502T)
Ref Sequence ENSEMBL: ENSMUSP00000086623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
AlphaFold Q9JMB8
Predicted Effect possibly damaging
Transcript: ENSMUST00000089215
AA Change: I502T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: I502T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161070
AA Change: I430T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: I430T

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162872
AA Change: I502T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: I502T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (109/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T A 2: 32,465,178 (GRCm39) probably benign Het
Aadacl2 C A 3: 59,932,573 (GRCm39) H363N probably damaging Het
Ace3 T G 11: 105,888,246 (GRCm39) S319A probably damaging Het
Amer3 C T 1: 34,627,900 (GRCm39) P713L possibly damaging Het
Aoah T C 13: 21,186,879 (GRCm39) L453P probably damaging Het
Asz1 A T 6: 18,051,290 (GRCm39) L463Q possibly damaging Het
Bpifb6 T A 2: 153,746,535 (GRCm39) V143D probably damaging Het
Cad T A 5: 31,230,000 (GRCm39) M1499K possibly damaging Het
Casp9 T A 4: 141,534,471 (GRCm39) C294S probably benign Het
Ccdc7b T A 8: 129,890,321 (GRCm39) S65T probably benign Het
Cdh23 G A 10: 60,143,306 (GRCm39) A3005V possibly damaging Het
Cfap54 T C 10: 92,805,565 (GRCm39) Y1515C possibly damaging Het
Chrm5 A C 2: 112,309,610 (GRCm39) F502C probably damaging Het
Cnst A T 1: 179,407,108 (GRCm39) T52S possibly damaging Het
Col7a1 G A 9: 108,787,457 (GRCm39) V617M unknown Het
Ctsb A G 14: 63,370,875 (GRCm39) D29G probably benign Het
Cyp3a44 T A 5: 145,725,202 (GRCm39) Q333L possibly damaging Het
Dnajc27 T C 12: 4,146,256 (GRCm39) V95A possibly damaging Het
Eea1 T A 10: 95,831,445 (GRCm39) Y179N probably damaging Het
Erbb2 T C 11: 98,326,107 (GRCm39) M961T probably damaging Het
Fat4 G A 3: 38,945,781 (GRCm39) G1558D probably damaging Het
Foxh1 T C 15: 76,553,126 (GRCm39) E196G probably damaging Het
Gcc2 T A 10: 58,105,217 (GRCm39) L151* probably null Het
Gcdh C T 8: 85,616,313 (GRCm39) G294D probably damaging Het
Gcnt3 A T 9: 69,941,693 (GRCm39) F292I probably damaging Het
Glod4 T C 11: 76,128,510 (GRCm39) S131G probably benign Het
Gpc2 G A 5: 138,272,586 (GRCm39) L576F unknown Het
Gphn G A 12: 78,609,646 (GRCm39) S330N possibly damaging Het
Heatr5a C T 12: 51,967,260 (GRCm39) C872Y probably damaging Het
Hephl1 G A 9: 14,995,775 (GRCm39) S449L probably benign Het
Hrh2 G T 13: 54,368,358 (GRCm39) M111I probably benign Het
Igfn1 A G 1: 135,925,544 (GRCm39) V70A probably benign Het
Il2 G A 3: 37,179,988 (GRCm39) T23I probably damaging Het
Irak4 A G 15: 94,460,917 (GRCm39) T382A possibly damaging Het
Itih2 A G 2: 10,128,297 (GRCm39) S135P possibly damaging Het
Kansl3 C T 1: 36,388,497 (GRCm39) D457N probably damaging Het
Kcns3 A G 12: 11,141,601 (GRCm39) I366T probably damaging Het
Kif26a C A 12: 112,145,719 (GRCm39) Y1743* probably null Het
Lama4 A T 10: 38,981,960 (GRCm39) I1730F probably damaging Het
Lax1 T C 1: 133,607,931 (GRCm39) N270S probably benign Het
Lrp1 G T 10: 127,403,233 (GRCm39) D2113E probably damaging Het
Lrp6 A G 6: 134,483,259 (GRCm39) V482A probably benign Het
Luzp2 A G 7: 54,914,108 (GRCm39) probably benign Het
Mc5r C A 18: 68,472,200 (GRCm39) D186E probably damaging Het
Mcph1 A T 8: 18,657,293 (GRCm39) probably null Het
Mgam A G 6: 40,705,905 (GRCm39) probably benign Het
Mmrn1 A C 6: 60,952,939 (GRCm39) T407P probably damaging Het
Mrpl1 T C 5: 96,386,806 (GRCm39) V265A probably benign Het
Mrpl15 C T 1: 4,846,856 (GRCm39) G240D probably damaging Het
Msx1 A T 5: 37,978,795 (GRCm39) M240K probably damaging Het
Mtf1 T C 4: 124,724,934 (GRCm39) L337P probably damaging Het
Muc5ac T A 7: 141,361,626 (GRCm39) C1646S probably damaging Het
Mvb12a C A 8: 71,999,638 (GRCm39) T219N probably damaging Het
Myo16 G A 8: 10,526,114 (GRCm39) V885M unknown Het
N4bp2 T A 5: 65,960,855 (GRCm39) S509T probably benign Het
Nckap1 A G 2: 80,383,750 (GRCm39) V144A possibly damaging Het
Nkx2-6 G T 14: 69,412,404 (GRCm39) G191C possibly damaging Het
Nmnat2 T C 1: 152,962,138 (GRCm39) I126T probably damaging Het
Nrp2 C T 1: 62,835,014 (GRCm39) R863W probably damaging Het
Nup188 C T 2: 30,226,726 (GRCm39) R1168C probably damaging Het
Oas3 T A 5: 120,892,754 (GRCm39) D1091V probably damaging Het
Optn T A 2: 5,036,126 (GRCm39) Q452L probably damaging Het
Or8b47 C T 9: 38,435,082 (GRCm39) T18I probably damaging Het
Pcca G A 14: 122,854,178 (GRCm39) V157I probably benign Het
Pcdha9 A G 18: 37,132,281 (GRCm39) D450G probably benign Het
Pcnx1 T A 12: 82,042,323 (GRCm39) S38T probably benign Het
Phrf1 C G 7: 140,840,055 (GRCm39) D1083E probably benign Het
Plaat5 T A 19: 7,596,691 (GRCm39) Y159* probably null Het
Plcb4 G A 2: 135,829,817 (GRCm39) A947T probably benign Het
Ppp1r3g G A 13: 36,152,834 (GRCm39) D85N possibly damaging Het
Pramel34 G A 5: 93,785,969 (GRCm39) H104Y possibly damaging Het
Prom2 A C 2: 127,380,185 (GRCm39) V349G probably damaging Het
Prrc2c C T 1: 162,541,843 (GRCm39) S382N probably benign Het
Rai14 A T 15: 10,592,204 (GRCm39) N230K probably benign Het
Rexo5 A T 7: 119,402,025 (GRCm39) K142I probably damaging Het
Rgs22 T C 15: 36,098,409 (GRCm39) H484R probably damaging Het
Rims2 C T 15: 39,543,086 (GRCm39) A1440V probably damaging Het
Serpinb1a T C 13: 33,026,946 (GRCm39) E332G probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Slc26a7 C T 4: 14,516,165 (GRCm39) G555S possibly damaging Het
Slc4a2 A T 5: 24,639,123 (GRCm39) D386V probably damaging Het
Slc6a17 C T 3: 107,384,551 (GRCm39) V350M probably damaging Het
Smc2 A G 4: 52,449,361 (GRCm39) Y174C probably damaging Het
Smoc2 A G 17: 14,619,686 (GRCm39) Y355C probably damaging Het
Smpd1 T A 7: 105,204,442 (GRCm39) V107E probably benign Het
Snapc1 T C 12: 74,018,773 (GRCm39) probably benign Het
Spata31e2 T C 1: 26,722,426 (GRCm39) D918G possibly damaging Het
Steap4 T G 5: 8,026,683 (GRCm39) F215L probably benign Het
Tbc1d1 T A 5: 64,435,364 (GRCm39) S501T probably damaging Het
Tec A G 5: 72,926,117 (GRCm39) Y312H probably damaging Het
Ticrr C A 7: 79,343,516 (GRCm39) T1127K possibly damaging Het
Tlk2 A G 11: 105,147,722 (GRCm39) D438G probably benign Het
Tln2 C A 9: 67,277,980 (GRCm39) V343L probably benign Het
Tmem156 T A 5: 65,231,148 (GRCm39) I241F probably damaging Het
Tmtc1 G T 6: 148,186,390 (GRCm39) N559K probably benign Het
Trbv4 A T 6: 41,036,696 (GRCm39) I74F probably benign Het
Trmt1l C T 1: 151,328,899 (GRCm39) P524S probably damaging Het
Trpa1 A T 1: 14,956,040 (GRCm39) C776* probably null Het
Ttc41 T A 10: 86,599,830 (GRCm39) S1043R probably benign Het
Ttn A G 2: 76,576,646 (GRCm39) L24749S probably damaging Het
Ube2o C T 11: 116,471,942 (GRCm39) G100R probably damaging Het
Unc5b T C 10: 60,609,532 (GRCm39) E588G possibly damaging Het
Usp43 G T 11: 67,770,922 (GRCm39) Q571K probably damaging Het
Vmn1r127 G A 7: 21,052,927 (GRCm39) P287L possibly damaging Het
Wasf3 T A 5: 146,397,857 (GRCm39) M208K possibly damaging Het
Xab2 A G 8: 3,663,000 (GRCm39) F527S possibly damaging Het
Zfp644 T G 5: 106,785,774 (GRCm39) N258H possibly damaging Het
Zfp947 A C 17: 22,364,594 (GRCm39) F360C probably damaging Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104,627,361 (GRCm39) missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104,751,484 (GRCm39) missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104,705,335 (GRCm39) splice site probably benign
IGL02028:Cntn6 APN 6 104,836,387 (GRCm39) missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104,823,103 (GRCm39) critical splice donor site probably null
IGL02557:Cntn6 APN 6 104,751,496 (GRCm39) missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104,781,347 (GRCm39) missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104,781,299 (GRCm39) missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104,753,418 (GRCm39) splice site probably benign
PIT4366001:Cntn6 UTSW 6 104,809,498 (GRCm39) missense probably benign 0.05
R0490:Cntn6 UTSW 6 104,810,879 (GRCm39) missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104,753,275 (GRCm39) missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104,840,109 (GRCm39) missense probably benign 0.00
R0654:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R0960:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R1241:Cntn6 UTSW 6 104,809,470 (GRCm39) missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104,838,861 (GRCm39) missense probably benign 0.07
R1401:Cntn6 UTSW 6 104,781,359 (GRCm39) missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R1542:Cntn6 UTSW 6 104,825,061 (GRCm39) missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104,809,541 (GRCm39) missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104,838,783 (GRCm39) nonsense probably null
R2097:Cntn6 UTSW 6 104,838,910 (GRCm39) missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104,545,989 (GRCm39) start gained probably benign
R2429:Cntn6 UTSW 6 104,627,526 (GRCm39) missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104,703,198 (GRCm39) missense probably benign 0.04
R4009:Cntn6 UTSW 6 104,810,783 (GRCm39) missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104,749,522 (GRCm39) missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104,705,245 (GRCm39) missense probably benign 0.20
R4666:Cntn6 UTSW 6 104,705,245 (GRCm39) missense probably benign 0.20
R4701:Cntn6 UTSW 6 104,781,321 (GRCm39) missense probably benign 0.01
R4780:Cntn6 UTSW 6 104,822,745 (GRCm39) missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104,836,436 (GRCm39) missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104,751,435 (GRCm39) missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104,749,558 (GRCm39) missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104,809,991 (GRCm39) missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104,546,074 (GRCm39) intron probably benign
R5291:Cntn6 UTSW 6 104,703,096 (GRCm39) missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104,809,523 (GRCm39) missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104,812,706 (GRCm39) missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104,810,064 (GRCm39) missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104,825,093 (GRCm39) missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104,744,851 (GRCm39) missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104,703,100 (GRCm39) missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104,627,461 (GRCm39) missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104,836,409 (GRCm39) missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104,838,907 (GRCm39) missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104,822,719 (GRCm39) frame shift probably null
R7012:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R7012:Cntn6 UTSW 6 104,703,223 (GRCm39) missense probably damaging 0.98
R7337:Cntn6 UTSW 6 104,627,491 (GRCm39) missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104,627,444 (GRCm39) missense probably benign 0.29
R8133:Cntn6 UTSW 6 104,705,298 (GRCm39) missense probably benign 0.19
R8463:Cntn6 UTSW 6 104,749,580 (GRCm39) missense possibly damaging 0.64
R8909:Cntn6 UTSW 6 104,825,093 (GRCm39) missense probably benign 0.05
R9232:Cntn6 UTSW 6 104,815,781 (GRCm39) missense probably damaging 1.00
R9454:Cntn6 UTSW 6 104,781,308 (GRCm39) missense possibly damaging 0.82
R9698:Cntn6 UTSW 6 104,810,044 (GRCm39) nonsense probably null
X0020:Cntn6 UTSW 6 104,744,845 (GRCm39) missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104,809,545 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTACAGGGGAACACCAG -3'
(R):5'- TAGCAATTTGAGACACTTACTCCCC -3'

Sequencing Primer
(F):5'- ACTTTTGGGATAGCATTGGAAATG -3'
(R):5'- CCAATTCGTTCAAAATGGGCTACTC -3'
Posted On 2022-03-25