Mutagenetix > Incidental Mutation

Incidental Mutation 'R9287:Ticrr'

704007

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R9287 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 79693768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1127 (T1127K)

Ref Sequence

ENSEMBL: ENSMUSP00000041377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]

AlphaFold

Q8BQ33

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035977
AA Change: T1127K

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: T1127K

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059836

SMART Domains

Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178048

SMART Domains

Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183846

SMART Domains

Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	908	918	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC
low complexity region	980	994	N/A	INTRINSIC
low complexity region	1050	1062	N/A	INTRINSIC
coiled coil region	1114	1140	N/A	INTRINSIC
coiled coil region	1187	1206	N/A	INTRINSIC
low complexity region	1294	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184137

SMART Domains

Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

Domain	Start	End	E-Value	Type
KISc	13	357	2.88e-143	SMART
low complexity region	391	410	N/A	INTRINSIC
Blast:KISc	413	481	1e-19	BLAST
Blast:KISc	482	518	3e-11	BLAST
low complexity region	523	540	N/A	INTRINSIC
low complexity region	543	557	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	669	685	N/A	INTRINSIC
Blast:KISc	780	879	2e-15	BLAST
low complexity region	927	944	N/A	INTRINSIC
low complexity region	979	993	N/A	INTRINSIC
low complexity region	1049	1061	N/A	INTRINSIC
coiled coil region	1113	1139	N/A	INTRINSIC
coiled coil region	1186	1205	N/A	INTRINSIC
low complexity region	1293	1304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206591

Predicted Effect

probably benign
Transcript: ENSMUST00000206622

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (109/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	C	1: 26,683,345	D918G	possibly damaging	Het
9430097D07Rik	T	A	2: 32,575,166		probably benign	Het
Aadacl2	C	A	3: 60,025,152	H363N	probably damaging	Het
Ace3	T	G	11: 105,997,420	S319A	probably damaging	Het
Amer3	C	T	1: 34,588,819	P713L	possibly damaging	Het
Aoah	T	C	13: 21,002,709	L453P	probably damaging	Het
Asz1	A	T	6: 18,051,291	L463Q	possibly damaging	Het
Bpifb6	T	A	2: 153,904,615	V143D	probably damaging	Het
C87414	G	A	5: 93,638,110	H104Y	possibly damaging	Het
Cad	T	A	5: 31,072,656	M1499K	possibly damaging	Het
Casp9	T	A	4: 141,807,160	C294S	probably benign	Het
Ccdc7b	T	A	8: 129,163,840	S65T	probably benign	Het
Cdh23	G	A	10: 60,307,527	A3005V	possibly damaging	Het
Cfap54	T	C	10: 92,969,703	Y1515C	possibly damaging	Het
Chrm5	A	C	2: 112,479,265	F502C	probably damaging	Het
Cnst	A	T	1: 179,579,543	T52S	possibly damaging	Het
Cntn6	T	C	6: 104,832,510	I502T	possibly damaging	Het
Col7a1	G	A	9: 108,958,389	V617M	unknown	Het
Ctsb	A	G	14: 63,133,426	D29G	probably benign	Het
Cyp3a44	T	A	5: 145,788,392	Q333L	possibly damaging	Het
Dnajc27	T	C	12: 4,096,256	V95A	possibly damaging	Het
Eea1	T	A	10: 95,995,583	Y179N	probably damaging	Het
Erbb2	T	C	11: 98,435,281	M961T	probably damaging	Het
Fat4	G	A	3: 38,891,632	G1558D	probably damaging	Het
Foxh1	T	C	15: 76,668,926	E196G	probably damaging	Het
Gcc2	T	A	10: 58,269,395	L151*	probably null	Het
Gcdh	C	T	8: 84,889,684	G294D	probably damaging	Het
Gcnt3	A	T	9: 70,034,411	F292I	probably damaging	Het
Glod4	T	C	11: 76,237,684	S131G	probably benign	Het
Gpc2	G	A	5: 138,274,324	L576F	unknown	Het
Gphn	G	A	12: 78,562,872	S330N	possibly damaging	Het
Heatr5a	C	T	12: 51,920,477	C872Y	probably damaging	Het
Hephl1	G	A	9: 15,084,479	S449L	probably benign	Het
Hrasls5	T	A	19: 7,619,326	Y159*	probably null	Het
Hrh2	G	T	13: 54,214,339	M111I	probably benign	Het
Igfn1	A	G	1: 135,997,806	V70A	probably benign	Het
Il2	G	A	3: 37,125,839	T23I	probably damaging	Het
Irak4	A	G	15: 94,563,036	T382A	possibly damaging	Het
Itih2	A	G	2: 10,123,486	S135P	possibly damaging	Het
Kansl3	C	T	1: 36,349,416	D457N	probably damaging	Het
Kcns3	A	G	12: 11,091,600	I366T	probably damaging	Het
Kif26a	C	A	12: 112,179,285	Y1743*	probably null	Het
Lama4	A	T	10: 39,105,964	I1730F	probably damaging	Het
Lax1	T	C	1: 133,680,193	N270S	probably benign	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp6	A	G	6: 134,506,296	V482A	probably benign	Het
Luzp2	A	G	7: 55,264,360		probably benign	Het
Mc5r	C	A	18: 68,339,129	D186E	probably damaging	Het
Mcph1	A	T	8: 18,607,277		probably null	Het
Mgam	A	G	6: 40,728,971		probably benign	Het
Mmrn1	A	C	6: 60,975,955	T407P	probably damaging	Het
Mrpl1	T	C	5: 96,238,947	V265A	probably benign	Het
Mrpl15	C	T	1: 4,776,633	G240D	probably damaging	Het
Msx1	A	T	5: 37,821,451	M240K	probably damaging	Het
Mtf1	T	C	4: 124,831,141	L337P	probably damaging	Het
Muc5ac	T	A	7: 141,807,889	C1646S	probably damaging	Het
Mvb12a	C	A	8: 71,546,994	T219N	probably damaging	Het
Myo16	G	A	8: 10,476,114	V885M	unknown	Het
N4bp2	T	A	5: 65,803,512	S509T	probably benign	Het
Nckap1	A	G	2: 80,553,406	V144A	possibly damaging	Het
Nkx2-6	G	T	14: 69,174,955	G191C	possibly damaging	Het
Nmnat2	T	C	1: 153,086,392	I126T	probably damaging	Het
Nrp2	C	T	1: 62,795,855	R863W	probably damaging	Het
Nup188	C	T	2: 30,336,714	R1168C	probably damaging	Het
Oas3	T	A	5: 120,754,689	D1091V	probably damaging	Het
Olfr911-ps1	C	T	9: 38,523,786	T18I	probably damaging	Het
Optn	T	A	2: 5,031,315	Q452L	probably damaging	Het
Pcca	G	A	14: 122,616,766	V157I	probably benign	Het
Pcdha9	A	G	18: 36,999,228	D450G	probably benign	Het
Pcnx	T	A	12: 81,995,549	S38T	probably benign	Het
Phrf1	C	G	7: 141,260,142	D1083E	probably benign	Het
Plcb4	G	A	2: 135,987,897	A947T	probably benign	Het
Ppp1r3g	G	A	13: 35,968,851	D85N	possibly damaging	Het
Prom2	A	C	2: 127,538,265	V349G	probably damaging	Het
Prrc2c	C	T	1: 162,714,274	S382N	probably benign	Het
Rai14	A	T	15: 10,592,118	N230K	probably benign	Het
Rexo5	A	T	7: 119,802,802	K142I	probably damaging	Het
Rgs22	T	C	15: 36,098,263	H484R	probably damaging	Het
Rims2	C	T	15: 39,679,690	A1440V	probably damaging	Het
Serpinb1a	T	C	13: 32,842,963	E332G	probably damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Slc26a7	C	T	4: 14,516,165	G555S	possibly damaging	Het
Slc4a2	A	T	5: 24,434,125	D386V	probably damaging	Het
Slc6a17	C	T	3: 107,477,235	V350M	probably damaging	Het
Smc2	A	G	4: 52,449,361	Y174C	probably damaging	Het
Smoc2	A	G	17: 14,399,424	Y355C	probably damaging	Het
Smpd1	T	A	7: 105,555,235	V107E	probably benign	Het
Snapc1	T	C	12: 73,971,999		probably benign	Het
Steap4	T	G	5: 7,976,683	F215L	probably benign	Het
Tbc1d1	T	A	5: 64,278,021	S501T	probably damaging	Het
Tec	A	G	5: 72,768,774	Y312H	probably damaging	Het
Tlk2	A	G	11: 105,256,896	D438G	probably benign	Het
Tln2	C	A	9: 67,370,698	V343L	probably benign	Het
Tmem156	T	A	5: 65,073,805	I241F	probably damaging	Het
Tmtc1	G	T	6: 148,284,892	N559K	probably benign	Het
Trbv4	A	T	6: 41,059,762	I74F	probably benign	Het
Trmt1l	C	T	1: 151,453,148	P524S	probably damaging	Het
Trpa1	A	T	1: 14,885,816	C776*	probably null	Het
Ttc41	T	A	10: 86,763,966	S1043R	probably benign	Het
Ttn	A	G	2: 76,746,302	L24749S	probably damaging	Het
Ube2o	C	T	11: 116,581,116	G100R	probably damaging	Het
Unc5b	T	C	10: 60,773,753	E588G	possibly damaging	Het
Usp43	G	T	11: 67,880,096	Q571K	probably damaging	Het
Vmn1r127	G	A	7: 21,319,002	P287L	possibly damaging	Het
Wasf3	T	A	5: 146,461,047	M208K	possibly damaging	Het
Xab2	A	G	8: 3,613,000	F527S	possibly damaging	Het
Zfp644	T	G	5: 106,637,908	N258H	possibly damaging	Het
Zfp947	A	C	17: 22,145,613	F360C	probably damaging	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	splice site	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R7935:Ticrr	UTSW	7	79681836	missense	probably damaging	0.99
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8080:Ticrr	UTSW	7	79684264	splice site	probably null
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92
R8349:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R8410:Ticrr	UTSW	7	79667675	missense	probably damaging	0.98
R8449:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R9073:Ticrr	UTSW	7	79667931	missense	probably benign	0.01
R9090:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9271:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9368:Ticrr	UTSW	7	79680987	missense	probably damaging	0.99
R9469:Ticrr	UTSW	7	79694763	missense	probably benign	0.03
R9502:Ticrr	UTSW	7	79693849	missense	probably benign
R9614:Ticrr	UTSW	7	79696006	missense	probably damaging	1.00
R9761:Ticrr	UTSW	7	79695565	missense	probably damaging	1.00
R9779:Ticrr	UTSW	7	79679054	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- GAGAGGGAACAGGTCACTATTC -3'
(R):5'- ATCAGACTCTCTGGGTGTGC -3'

Sequencing Primer
(F):5'- GGGAACAGGTCACTATTCTAGATTCC -3'
(R):5'- AGGGGAGGAGAGGTCTCTTC -3'

Posted On

2022-03-25