Mutagenetix > Incidental Mutation

Incidental Mutation 'R9287:Muc5ac'

704015

Institutional Source

Beutler Lab

Gene Symbol

Muc5ac

Ensembl Gene

ENSMUSG00000037974

Gene Name

mucin 5, subtypes A and C, tracheobronchial/gastric

Synonyms

MGM, 2210005L13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9287 (G1)

Quality Score

141.008

Status

Not validated

Chromosome

Chromosomal Location

141788972-141819231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 141807889 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1646 (C1646S)

Ref Sequence

ENSEMBL: ENSMUSP00000122353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041924
AA Change: C1645S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: C1645S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	1.6e-14	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	6.1e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1482	2.3e-25	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1692	2.2e-27	PFAM
Pfam:Mucin2_WxxW	1765	1857	8.6e-27	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000155534
AA Change: C1646S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: C1646S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	9.6e-15	PFAM
VWC	395	437	3.54e-1	SMART
VWD	422	586	2.35e-33	SMART
C8	623	697	8.42e-36	SMART
Pfam:TIL	703	760	3.6e-9	PFAM
VWC	762	826	6.75e-1	SMART
VWC	864	906	4.06e-1	SMART
VWD	891	1051	1.51e-45	SMART
C8	1087	1161	2.78e-36	SMART
low complexity region	1316	1331	N/A	INTRINSIC
low complexity region	1334	1367	N/A	INTRINSIC
low complexity region	1372	1388	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1395	1483	1.3e-25	PFAM
low complexity region	1522	1533	N/A	INTRINSIC
low complexity region	1537	1564	N/A	INTRINSIC
low complexity region	1579	1596	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1605	1693	1.3e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163321

SMART Domains

Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	7.9e-15	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	1.9e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1481	1.1e-23	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1691	1.1e-25	PFAM
Pfam:Mucin2_WxxW	1765	1856	6.3e-24	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (109/109)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	C	1: 26,683,345	D918G	possibly damaging	Het
9430097D07Rik	T	A	2: 32,575,166		probably benign	Het
Aadacl2	C	A	3: 60,025,152	H363N	probably damaging	Het
Ace3	T	G	11: 105,997,420	S319A	probably damaging	Het
Amer3	C	T	1: 34,588,819	P713L	possibly damaging	Het
Aoah	T	C	13: 21,002,709	L453P	probably damaging	Het
Asz1	A	T	6: 18,051,291	L463Q	possibly damaging	Het
Bpifb6	T	A	2: 153,904,615	V143D	probably damaging	Het
C87414	G	A	5: 93,638,110	H104Y	possibly damaging	Het
Cad	T	A	5: 31,072,656	M1499K	possibly damaging	Het
Casp9	T	A	4: 141,807,160	C294S	probably benign	Het
Ccdc7b	T	A	8: 129,163,840	S65T	probably benign	Het
Cdh23	G	A	10: 60,307,527	A3005V	possibly damaging	Het
Cfap54	T	C	10: 92,969,703	Y1515C	possibly damaging	Het
Chrm5	A	C	2: 112,479,265	F502C	probably damaging	Het
Cnst	A	T	1: 179,579,543	T52S	possibly damaging	Het
Cntn6	T	C	6: 104,832,510	I502T	possibly damaging	Het
Col7a1	G	A	9: 108,958,389	V617M	unknown	Het
Ctsb	A	G	14: 63,133,426	D29G	probably benign	Het
Cyp3a44	T	A	5: 145,788,392	Q333L	possibly damaging	Het
Dnajc27	T	C	12: 4,096,256	V95A	possibly damaging	Het
Eea1	T	A	10: 95,995,583	Y179N	probably damaging	Het
Erbb2	T	C	11: 98,435,281	M961T	probably damaging	Het
Fat4	G	A	3: 38,891,632	G1558D	probably damaging	Het
Foxh1	T	C	15: 76,668,926	E196G	probably damaging	Het
Gcc2	T	A	10: 58,269,395	L151*	probably null	Het
Gcdh	C	T	8: 84,889,684	G294D	probably damaging	Het
Gcnt3	A	T	9: 70,034,411	F292I	probably damaging	Het
Glod4	T	C	11: 76,237,684	S131G	probably benign	Het
Gpc2	G	A	5: 138,274,324	L576F	unknown	Het
Gphn	G	A	12: 78,562,872	S330N	possibly damaging	Het
Heatr5a	C	T	12: 51,920,477	C872Y	probably damaging	Het
Hephl1	G	A	9: 15,084,479	S449L	probably benign	Het
Hrasls5	T	A	19: 7,619,326	Y159*	probably null	Het
Hrh2	G	T	13: 54,214,339	M111I	probably benign	Het
Igfn1	A	G	1: 135,997,806	V70A	probably benign	Het
Il2	G	A	3: 37,125,839	T23I	probably damaging	Het
Irak4	A	G	15: 94,563,036	T382A	possibly damaging	Het
Itih2	A	G	2: 10,123,486	S135P	possibly damaging	Het
Kansl3	C	T	1: 36,349,416	D457N	probably damaging	Het
Kcns3	A	G	12: 11,091,600	I366T	probably damaging	Het
Kif26a	C	A	12: 112,179,285	Y1743*	probably null	Het
Lama4	A	T	10: 39,105,964	I1730F	probably damaging	Het
Lax1	T	C	1: 133,680,193	N270S	probably benign	Het
Lrp1	G	T	10: 127,567,364	D2113E	probably damaging	Het
Lrp6	A	G	6: 134,506,296	V482A	probably benign	Het
Luzp2	A	G	7: 55,264,360		probably benign	Het
Mc5r	C	A	18: 68,339,129	D186E	probably damaging	Het
Mcph1	A	T	8: 18,607,277		probably null	Het
Mgam	A	G	6: 40,728,971		probably benign	Het
Mmrn1	A	C	6: 60,975,955	T407P	probably damaging	Het
Mrpl1	T	C	5: 96,238,947	V265A	probably benign	Het
Mrpl15	C	T	1: 4,776,633	G240D	probably damaging	Het
Msx1	A	T	5: 37,821,451	M240K	probably damaging	Het
Mtf1	T	C	4: 124,831,141	L337P	probably damaging	Het
Mvb12a	C	A	8: 71,546,994	T219N	probably damaging	Het
Myo16	G	A	8: 10,476,114	V885M	unknown	Het
N4bp2	T	A	5: 65,803,512	S509T	probably benign	Het
Nckap1	A	G	2: 80,553,406	V144A	possibly damaging	Het
Nkx2-6	G	T	14: 69,174,955	G191C	possibly damaging	Het
Nmnat2	T	C	1: 153,086,392	I126T	probably damaging	Het
Nrp2	C	T	1: 62,795,855	R863W	probably damaging	Het
Nup188	C	T	2: 30,336,714	R1168C	probably damaging	Het
Oas3	T	A	5: 120,754,689	D1091V	probably damaging	Het
Olfr911-ps1	C	T	9: 38,523,786	T18I	probably damaging	Het
Optn	T	A	2: 5,031,315	Q452L	probably damaging	Het
Pcca	G	A	14: 122,616,766	V157I	probably benign	Het
Pcdha9	A	G	18: 36,999,228	D450G	probably benign	Het
Pcnx	T	A	12: 81,995,549	S38T	probably benign	Het
Phrf1	C	G	7: 141,260,142	D1083E	probably benign	Het
Plcb4	G	A	2: 135,987,897	A947T	probably benign	Het
Ppp1r3g	G	A	13: 35,968,851	D85N	possibly damaging	Het
Prom2	A	C	2: 127,538,265	V349G	probably damaging	Het
Prrc2c	C	T	1: 162,714,274	S382N	probably benign	Het
Rai14	A	T	15: 10,592,118	N230K	probably benign	Het
Rexo5	A	T	7: 119,802,802	K142I	probably damaging	Het
Rgs22	T	C	15: 36,098,263	H484R	probably damaging	Het
Rims2	C	T	15: 39,679,690	A1440V	probably damaging	Het
Serpinb1a	T	C	13: 32,842,963	E332G	probably damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Slc26a7	C	T	4: 14,516,165	G555S	possibly damaging	Het
Slc4a2	A	T	5: 24,434,125	D386V	probably damaging	Het
Slc6a17	C	T	3: 107,477,235	V350M	probably damaging	Het
Smc2	A	G	4: 52,449,361	Y174C	probably damaging	Het
Smoc2	A	G	17: 14,399,424	Y355C	probably damaging	Het
Smpd1	T	A	7: 105,555,235	V107E	probably benign	Het
Snapc1	T	C	12: 73,971,999		probably benign	Het
Steap4	T	G	5: 7,976,683	F215L	probably benign	Het
Tbc1d1	T	A	5: 64,278,021	S501T	probably damaging	Het
Tec	A	G	5: 72,768,774	Y312H	probably damaging	Het
Ticrr	C	A	7: 79,693,768	T1127K	possibly damaging	Het
Tlk2	A	G	11: 105,256,896	D438G	probably benign	Het
Tln2	C	A	9: 67,370,698	V343L	probably benign	Het
Tmem156	T	A	5: 65,073,805	I241F	probably damaging	Het
Tmtc1	G	T	6: 148,284,892	N559K	probably benign	Het
Trbv4	A	T	6: 41,059,762	I74F	probably benign	Het
Trmt1l	C	T	1: 151,453,148	P524S	probably damaging	Het
Trpa1	A	T	1: 14,885,816	C776*	probably null	Het
Ttc41	T	A	10: 86,763,966	S1043R	probably benign	Het
Ttn	A	G	2: 76,746,302	L24749S	probably damaging	Het
Ube2o	C	T	11: 116,581,116	G100R	probably damaging	Het
Unc5b	T	C	10: 60,773,753	E588G	possibly damaging	Het
Usp43	G	T	11: 67,880,096	Q571K	probably damaging	Het
Vmn1r127	G	A	7: 21,319,002	P287L	possibly damaging	Het
Wasf3	T	A	5: 146,461,047	M208K	possibly damaging	Het
Xab2	A	G	8: 3,613,000	F527S	possibly damaging	Het
Zfp644	T	G	5: 106,637,908	N258H	possibly damaging	Het
Zfp947	A	C	17: 22,145,613	F360C	probably damaging	Het

Other mutations in Muc5ac

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Muc5ac	APN	7	141812703	missense	possibly damaging	0.93
IGL01064:Muc5ac	APN	7	141807473	missense	probably benign	0.12
IGL01155:Muc5ac	APN	7	141806943	splice site	probably benign
IGL01452:Muc5ac	APN	7	141817555	missense	probably benign	0.00
IGL01590:Muc5ac	APN	7	141798893	missense	probably benign	0.02
IGL02104:Muc5ac	APN	7	141811078	missense	probably damaging	0.98
IGL02152:Muc5ac	APN	7	141800177	missense	possibly damaging	0.86
IGL02153:Muc5ac	APN	7	141818800	nonsense	probably null
IGL02178:Muc5ac	APN	7	141805447	splice site	probably benign
IGL02403:Muc5ac	APN	7	141803450	missense	possibly damaging	0.71
IGL02576:Muc5ac	APN	7	141817044	missense	probably benign	0.01
IGL02665:Muc5ac	APN	7	141791086	missense	possibly damaging	0.71
IGL02704:Muc5ac	APN	7	141795263	missense	possibly damaging	0.71
IGL02808:Muc5ac	APN	7	141805775	missense	possibly damaging	0.72
IGL03283:Muc5ac	APN	7	141813781	missense	probably benign	0.34
IGL03384:Muc5ac	APN	7	141812403	missense	possibly damaging	0.71
IGL03046:Muc5ac	UTSW	7	141795213	missense	probably benign	0.27
PIT4515001:Muc5ac	UTSW	7	141807416	missense	probably damaging	0.99
R0092:Muc5ac	UTSW	7	141818630	missense	possibly damaging	0.72
R0145:Muc5ac	UTSW	7	141795275	missense	possibly damaging	0.71
R0147:Muc5ac	UTSW	7	141811039	missense	probably benign	0.08
R0363:Muc5ac	UTSW	7	141800960	missense	probably benign	0.01
R0384:Muc5ac	UTSW	7	141812251	missense	possibly damaging	0.71
R0440:Muc5ac	UTSW	7	141792034	nonsense	probably null
R0583:Muc5ac	UTSW	7	141807608	missense	probably damaging	0.99
R0616:Muc5ac	UTSW	7	141796244	missense	probably benign	0.02
R0682:Muc5ac	UTSW	7	141805669	missense	possibly damaging	0.53
R0685:Muc5ac	UTSW	7	141807709	missense	probably benign	0.03
R0883:Muc5ac	UTSW	7	141796265	missense	possibly damaging	0.71
R0924:Muc5ac	UTSW	7	141807515	missense	possibly damaging	0.68
R1300:Muc5ac	UTSW	7	141816929	missense	possibly damaging	0.73
R1315:Muc5ac	UTSW	7	141807323	missense	probably damaging	0.99
R1354:Muc5ac	UTSW	7	141807377	missense	probably damaging	0.99
R1484:Muc5ac	UTSW	7	141813892	splice site	probably null
R1599:Muc5ac	UTSW	7	141798903	missense	possibly damaging	0.52
R1758:Muc5ac	UTSW	7	141801531	missense	possibly damaging	0.86
R1837:Muc5ac	UTSW	7	141807086	missense	probably benign	0.00
R1911:Muc5ac	UTSW	7	141796304	missense	probably benign	0.18
R1922:Muc5ac	UTSW	7	141793689	missense	probably benign	0.03
R1966:Muc5ac	UTSW	7	141803376	missense	possibly damaging	0.92
R1994:Muc5ac	UTSW	7	141813152	missense	possibly damaging	0.93
R2056:Muc5ac	UTSW	7	141792035	missense	probably benign	0.01
R2126:Muc5ac	UTSW	7	141810742	missense	possibly damaging	0.84
R2170:Muc5ac	UTSW	7	141812347	missense	possibly damaging	0.93
R2258:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2259:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2293:Muc5ac	UTSW	7	141807199	missense	probably damaging	0.99
R2435:Muc5ac	UTSW	7	141818104	missense	possibly damaging	0.53
R2895:Muc5ac	UTSW	7	141791140	missense	possibly damaging	0.92
R2910:Muc5ac	UTSW	7	141807641	missense	probably damaging	0.99
R3154:Muc5ac	UTSW	7	141792736	splice site	probably null
R3762:Muc5ac	UTSW	7	141807475	missense	possibly damaging	0.53
R3791:Muc5ac	UTSW	7	141798501	missense	probably benign	0.32
R3806:Muc5ac	UTSW	7	141813734	missense	possibly damaging	0.91
R3825:Muc5ac	UTSW	7	141814723	missense	possibly damaging	0.92
R3888:Muc5ac	UTSW	7	141791224	missense	possibly damaging	0.51
R3929:Muc5ac	UTSW	7	141802892	missense	probably benign
R3981:Muc5ac	UTSW	7	141813775	missense	possibly damaging	0.86
R4034:Muc5ac	UTSW	7	141799844	critical splice donor site	probably null
R4043:Muc5ac	UTSW	7	141807478	missense	possibly damaging	0.53
R4061:Muc5ac	UTSW	7	141811130	missense	possibly damaging	0.85
R4106:Muc5ac	UTSW	7	141802835	missense	possibly damaging	0.86
R4206:Muc5ac	UTSW	7	141817110	missense	possibly damaging	0.73
R4613:Muc5ac	UTSW	7	141791103	missense	possibly damaging	0.93
R4719:Muc5ac	UTSW	7	141789763	missense	possibly damaging	0.83
R4751:Muc5ac	UTSW	7	141817601	missense	probably benign	0.00
R4789:Muc5ac	UTSW	7	141798882	missense	possibly damaging	0.86
R4928:Muc5ac	UTSW	7	141817902	nonsense	probably null
R4971:Muc5ac	UTSW	7	141816278	missense	possibly damaging	0.68
R4982:Muc5ac	UTSW	7	141809456	intron	probably benign
R5088:Muc5ac	UTSW	7	141796319	missense	possibly damaging	0.53
R5141:Muc5ac	UTSW	7	141814742	missense	possibly damaging	0.72
R5224:Muc5ac	UTSW	7	141793971	missense	probably benign	0.32
R5366:Muc5ac	UTSW	7	141807550	missense	probably benign	0.01
R5497:Muc5ac	UTSW	7	141807643	missense	probably damaging	0.99
R5507:Muc5ac	UTSW	7	141807832	missense	possibly damaging	0.72
R5643:Muc5ac	UTSW	7	141793715	critical splice donor site	probably null
R5811:Muc5ac	UTSW	7	141798984	missense	possibly damaging	0.51
R5946:Muc5ac	UTSW	7	141817907	missense	possibly damaging	0.73
R5970:Muc5ac	UTSW	7	141790669	nonsense	probably null
R5977:Muc5ac	UTSW	7	141796367	missense	possibly damaging	0.73
R6051:Muc5ac	UTSW	7	141811857	missense	possibly damaging	0.53
R6126:Muc5ac	UTSW	7	141801232	missense	possibly damaging	0.71
R6159:Muc5ac	UTSW	7	141815586	missense	possibly damaging	0.53
R6256:Muc5ac	UTSW	7	141789795	missense	possibly damaging	0.53
R6283:Muc5ac	UTSW	7	141816864	nonsense	probably null
R6341:Muc5ac	UTSW	7	141801492	missense	probably damaging	0.99
R6356:Muc5ac	UTSW	7	141812679	missense	probably benign	0.05
R6481:Muc5ac	UTSW	7	141809071	intron	probably benign
R6483:Muc5ac	UTSW	7	141802854	missense	probably benign	0.18
R6627:Muc5ac	UTSW	7	141808690	intron	probably benign
R6636:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6637:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6656:Muc5ac	UTSW	7	141803328	missense	probably damaging	0.98
R6721:Muc5ac	UTSW	7	141798992	missense	possibly damaging	0.71
R6794:Muc5ac	UTSW	7	141809552	intron	probably benign
R6844:Muc5ac	UTSW	7	141809744	intron	probably benign
R6847:Muc5ac	UTSW	7	141809744	intron	probably benign
R6852:Muc5ac	UTSW	7	141816907	missense	probably benign	0.03
R6862:Muc5ac	UTSW	7	141809744	intron	probably benign
R6863:Muc5ac	UTSW	7	141809744	intron	probably benign
R6864:Muc5ac	UTSW	7	141809744	intron	probably benign
R6865:Muc5ac	UTSW	7	141809744	intron	probably benign
R6874:Muc5ac	UTSW	7	141809744	intron	probably benign
R6875:Muc5ac	UTSW	7	141809744	intron	probably benign
R6876:Muc5ac	UTSW	7	141809744	intron	probably benign
R6877:Muc5ac	UTSW	7	141809744	intron	probably benign
R6889:Muc5ac	UTSW	7	141809744	intron	probably benign
R6920:Muc5ac	UTSW	7	141793298	missense	possibly damaging	0.86
R6998:Muc5ac	UTSW	7	141818714	missense	possibly damaging	0.92
R7017:Muc5ac	UTSW	7	141809687	intron	probably benign
R7091:Muc5ac	UTSW	7	141809687	intron	probably benign
R7092:Muc5ac	UTSW	7	141809648	intron	probably benign
R7092:Muc5ac	UTSW	7	141809687	intron	probably benign
R7110:Muc5ac	UTSW	7	141799822	missense	possibly damaging	0.95
R7117:Muc5ac	UTSW	7	141813822	nonsense	probably null
R7238:Muc5ac	UTSW	7	141809517	missense	unknown
R7238:Muc5ac	UTSW	7	141809687	intron	probably benign
R7396:Muc5ac	UTSW	7	141808415	missense	unknown
R7456:Muc5ac	UTSW	7	141793167	missense	probably benign	0.32
R7477:Muc5ac	UTSW	7	141816282	missense	possibly damaging	0.72
R7530:Muc5ac	UTSW	7	141813799	missense	possibly damaging	0.51
R7545:Muc5ac	UTSW	7	141808668	missense	unknown
R7604:Muc5ac	UTSW	7	141809709	missense	unknown
R7635:Muc5ac	UTSW	7	141805676	missense	probably damaging	0.98
R7635:Muc5ac	UTSW	7	141805753	missense	possibly damaging	0.53
R7650:Muc5ac	UTSW	7	141809422	missense	unknown
R7651:Muc5ac	UTSW	7	141796254	missense	possibly damaging	0.92
R7685:Muc5ac	UTSW	7	141809383	missense	unknown
R7720:Muc5ac	UTSW	7	141809303	missense	unknown
R7749:Muc5ac	UTSW	7	141809303	missense	unknown
R7750:Muc5ac	UTSW	7	141809303	missense	unknown
R7751:Muc5ac	UTSW	7	141809303	missense	unknown
R7754:Muc5ac	UTSW	7	141809303	missense	unknown
R7798:Muc5ac	UTSW	7	141794041	critical splice donor site	probably null
R7835:Muc5ac	UTSW	7	141809303	missense	unknown
R7837:Muc5ac	UTSW	7	141815963	missense	possibly damaging	0.53
R7858:Muc5ac	UTSW	7	141803429	missense	possibly damaging	0.51
R7866:Muc5ac	UTSW	7	141795852	missense	probably benign	0.00
R7874:Muc5ac	UTSW	7	141809303	missense	unknown
R7876:Muc5ac	UTSW	7	141809303	missense	unknown
R7877:Muc5ac	UTSW	7	141809303	missense	unknown
R7881:Muc5ac	UTSW	7	141809303	missense	unknown
R7884:Muc5ac	UTSW	7	141809303	missense	unknown
R7921:Muc5ac	UTSW	7	141809687	intron	probably benign
R7976:Muc5ac	UTSW	7	141809791	missense	unknown
R8104:Muc5ac	UTSW	7	141804783	missense	possibly damaging	0.96
R8177:Muc5ac	UTSW	7	141807331	missense	probably damaging	1.00
R8214:Muc5ac	UTSW	7	141802948	missense	possibly damaging	0.53
R8292:Muc5ac	UTSW	7	141809263	missense	unknown
R8386:Muc5ac	UTSW	7	141807634	missense	possibly damaging	0.93
R8400:Muc5ac	UTSW	7	141810476	missense	probably damaging	0.99
R8504:Muc5ac	UTSW	7	141807155	missense	probably damaging	1.00
R8709:Muc5ac	UTSW	7	141816926	missense	possibly damaging	0.96
R8725:Muc5ac	UTSW	7	141809744	intron	probably benign
R8727:Muc5ac	UTSW	7	141809744	intron	probably benign
R8754:Muc5ac	UTSW	7	141800271	missense	possibly damaging	0.85
R8769:Muc5ac	UTSW	7	141818872	missense	probably damaging	1.00
R8933:Muc5ac	UTSW	7	141789756	missense	possibly damaging	0.59
R8939:Muc5ac	UTSW	7	141793354	missense	probably damaging	0.98
R9049:Muc5ac	UTSW	7	141808975	missense	unknown
R9124:Muc5ac	UTSW	7	141809792	missense	unknown
R9131:Muc5ac	UTSW	7	141809792	missense	unknown
R9132:Muc5ac	UTSW	7	141809792	missense	unknown
R9135:Muc5ac	UTSW	7	141798481	missense	probably damaging	0.99
R9156:Muc5ac	UTSW	7	141809792	missense	unknown
R9157:Muc5ac	UTSW	7	141809792	missense	unknown
R9159:Muc5ac	UTSW	7	141809792	missense	unknown
R9160:Muc5ac	UTSW	7	141809792	missense	unknown
R9161:Muc5ac	UTSW	7	141799289	missense	possibly damaging	0.53
R9175:Muc5ac	UTSW	7	141812356	missense	possibly damaging	0.92
R9183:Muc5ac	UTSW	7	141798900	missense	possibly damaging	0.71
R9218:Muc5ac	UTSW	7	141807361	missense	probably damaging	0.99
R9219:Muc5ac	UTSW	7	141817063	nonsense	probably null
R9239:Muc5ac	UTSW	7	141800217	missense	probably damaging	0.99
R9246:Muc5ac	UTSW	7	141810478	missense	probably benign	0.11
R9320:Muc5ac	UTSW	7	141815518	missense	probably benign	0.01
R9327:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
R9428:Muc5ac	UTSW	7	141808822	missense	unknown
R9430:Muc5ac	UTSW	7	141808832	missense	unknown
R9454:Muc5ac	UTSW	7	141808694	missense	unknown
R9483:Muc5ac	UTSW	7	141811728	nonsense	probably null
R9581:Muc5ac	UTSW	7	141810062	missense	unknown
R9610:Muc5ac	UTSW	7	141796341	missense	possibly damaging	0.86
R9642:Muc5ac	UTSW	7	141795864	missense	possibly damaging	0.71
R9684:Muc5ac	UTSW	7	141811061	missense	probably benign	0.41
R9760:Muc5ac	UTSW	7	141807248	missense	probably benign	0.05
R9778:Muc5ac	UTSW	7	141795284	nonsense	probably null
X0060:Muc5ac	UTSW	7	141803333	missense	possibly damaging	0.71
Z1088:Muc5ac	UTSW	7	141809744	intron	probably benign
Z1088:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
Z1177:Muc5ac	UTSW	7	141809224	missense	unknown
Z1177:Muc5ac	UTSW	7	141818040	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- ATCTCAACCTCAGGGTCCAC -3'
(R):5'- TTTCGTGCTGACTCCATGTG -3'

Sequencing Primer
(F):5'- AGGGTCCACCATGCCTTC -3'
(R):5'- TGTGGTAACTGAAGCTGTGGAAC -3'

Posted On

2022-03-25