Incidental Mutation 'R0755:Slc4a2'
ID70402
Institutional Source Beutler Lab
Gene Symbol Slc4a2
Ensembl Gene ENSMUSG00000028962
Gene Namesolute carrier family 4 (anion exchanger), member 2
SynonymsB3RP, Ae2
MMRRC Submission 038935-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R0755 (G1)
Quality Score216
Status Not validated
Chromosome5
Chromosomal Location24423837-24440950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24435577 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 652 (A652T)
Ref Sequence ENSEMBL: ENSMUSP00000110699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080067] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049]
Predicted Effect probably benign
Transcript: ENSMUST00000080067
AA Change: A666T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962
AA Change: A666T

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115043
SMART Domains Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 273 341 7.6e-24 PFAM
Pfam:FAST_2 349 440 6.9e-26 PFAM
Pfam:RAP 475 513 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115047
AA Change: A652T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962
AA Change: A652T

DomainStartEndE-ValueType
low complexity region 79 96 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
low complexity region 155 164 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
low complexity region 282 299 N/A INTRINSIC
Pfam:Band_3_cyto 334 602 7.2e-108 PFAM
Pfam:HCO3_cotransp 656 1151 1e-244 PFAM
transmembrane domain 1169 1186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115049
AA Change: A657T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962
AA Change: A657T

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
low complexity region 103 126 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Band_3_cyto 339 607 7.3e-108 PFAM
Pfam:HCO3_cotransp 661 1156 1e-244 PFAM
transmembrane domain 1174 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198786
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the anion exchanger family of membrane transport proteins. The encoded protein regulates intracellular pH, biliary bicarbonate secretion, and chloride uptake. Reduced expression of this gene may be associated with primary biliary cirrhosis (PBC) in human patients, while differential expression of this gene may be associated with malignant hepatocellular carcinoma, colon and gastric cancers. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice carrying an isoform-specific allele display male infertility associated with disrupted spermiogenesis and germ cell apoptosis. Mice homozygous for a null allele display perinatal and postnatal lethality, loss of gastric acid secretion, failure of tooth eruption, aphagia, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,946,364 S1231P probably damaging Het
A730061H03Rik A T 14: 55,560,181 probably benign Het
Acin1 A G 14: 54,651,835 M1T probably null Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Aldh1a1 A G 19: 20,617,994 M96V probably benign Het
Ankfn1 T A 11: 89,392,087 M245L probably benign Het
Arhgap19 T C 19: 41,781,175 K54E probably damaging Het
Atp1a2 T C 1: 172,289,381 Q223R probably benign Het
Atp8a2 C T 14: 60,009,881 V557I possibly damaging Het
AU041133 A T 10: 82,150,890 K126* probably null Het
Axin1 T A 17: 26,182,506 Y351N possibly damaging Het
Baiap2l1 T C 5: 144,284,557 K176E probably damaging Het
Baz2a C T 10: 128,119,691 T848I possibly damaging Het
Bbs2 A C 8: 94,082,080 V333G probably benign Het
BC051019 G A 7: 109,716,095 Q318* probably null Het
Cdc37 C T 9: 21,139,864 D362N probably damaging Het
Cep170 A T 1: 176,755,753 V1020E probably damaging Het
Chrm4 T C 2: 91,928,402 V385A probably benign Het
Cntrl G A 2: 35,145,139 S373N probably damaging Het
Col23a1 G A 11: 51,576,879 G19D probably damaging Het
Cyb5r4 G T 9: 87,029,572 A100S probably damaging Het
Dctn1 C T 6: 83,189,077 P115S probably damaging Het
Dhrs2 C T 14: 55,234,790 T46M probably damaging Het
Disp2 T C 2: 118,789,762 F325S probably benign Het
Dnah11 T G 12: 117,954,829 T3456P possibly damaging Het
Dnah11 C A 12: 118,198,625 V70F probably benign Het
Duoxa1 T A 2: 122,304,680 T195S probably benign Het
Eif2ak1 T A 5: 143,884,924 F353I possibly damaging Het
Esam A G 9: 37,536,702 T211A probably damaging Het
Faf1 A G 4: 109,961,839 N636S probably benign Het
Fbxo25 A G 8: 13,935,219 Y305C probably benign Het
Fchsd1 C T 18: 37,968,750 probably null Het
Fdxacb1 T A 9: 50,771,725 D329E possibly damaging Het
Gm4070 A T 7: 105,896,685 F2387I possibly damaging Het
Hbq1b A T 11: 32,287,104 probably null Het
Hmcn2 T A 2: 31,453,160 V4566E probably damaging Het
Igkv6-29 G A 6: 70,139,069 T5I probably benign Het
Itfg1 A T 8: 85,726,205 D511E possibly damaging Het
Jmjd1c C T 10: 67,096,599 probably benign Het
Kat6b T A 14: 21,637,593 M570K probably damaging Het
Kdm4d T A 9: 14,464,295 K89M probably damaging Het
Krt19 A T 11: 100,142,139 D194E possibly damaging Het
Lamc1 A T 1: 153,247,450 Y665N possibly damaging Het
Lct A T 1: 128,294,135 S1556T possibly damaging Het
Macf1 A G 4: 123,369,926 L4924P probably damaging Het
Mef2c G A 13: 83,656,353 probably null Het
Mff G A 1: 82,750,605 probably null Het
Mycbp2 A T 14: 103,174,794 L2581Q probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nos3 T A 5: 24,367,297 L123M probably damaging Het
Ntn5 C T 7: 45,686,528 P128S probably benign Het
Nudt9 T C 5: 104,065,054 V331A probably damaging Het
Olfr131 A T 17: 38,082,194 Y261* probably null Het
Olfr854 T C 9: 19,567,119 I88M possibly damaging Het
Pcdh7 A T 5: 57,720,322 K406N possibly damaging Het
Pkdrej T A 15: 85,816,135 I1867L probably benign Het
Plppr4 C T 3: 117,322,670 G455R possibly damaging Het
Pramef6 A G 4: 143,897,729 V66A probably damaging Het
Prkag2 G C 5: 24,947,631 S158R probably benign Het
Ptprq T G 10: 107,582,539 T1659P probably benign Het
Rasl12 A G 9: 65,410,959 K202E probably benign Het
Rb1 A C 14: 73,197,213 *922G probably null Het
Rsf1 C T 7: 97,579,967 P22S probably damaging Het
Scn1a T G 2: 66,321,035 T797P probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc22a7 T G 17: 46,438,187 H68P possibly damaging Het
Slc5a1 T A 5: 33,133,389 L106M probably benign Het
Slco1c1 C T 6: 141,531,532 P19S probably damaging Het
Snx1 A G 9: 66,098,456 F127S probably damaging Het
Snx31 A T 15: 36,534,430 I199N probably damaging Het
Snx33 T C 9: 56,925,457 I443V possibly damaging Het
Sptbn1 A G 11: 30,139,016 F749L probably damaging Het
Stoml3 T A 3: 53,498,138 Y53* probably null Het
Stxbp2 A G 8: 3,642,019 T554A probably benign Het
Tal1 T C 4: 115,068,376 I214T probably damaging Het
Tas2r137 T A 6: 40,491,410 I58N probably damaging Het
Thap1 A G 8: 26,158,473 Y8C probably damaging Het
Thsd7a A T 6: 12,555,369 L172Q probably damaging Het
Ube3c T A 5: 29,637,742 D735E probably damaging Het
Unc80 G A 1: 66,504,923 D402N probably damaging Het
Upf1 G T 8: 70,334,129 R902S probably benign Het
Urb1 A G 16: 90,774,094 Y1276H probably damaging Het
Urb1 A T 16: 90,779,138 F843L probably benign Het
Vmn1r198 C T 13: 22,355,232 T296I probably benign Het
Vmn1r33 A T 6: 66,611,908 S221T probably damaging Het
Vmn2r103 A G 17: 19,773,568 D69G probably benign Het
Vmn2r14 T G 5: 109,216,360 L563F possibly damaging Het
Vmn2r60 G A 7: 42,195,445 G744D probably damaging Het
Vstm4 T C 14: 32,892,644 V181A probably damaging Het
Wdr60 T C 12: 116,211,792 I922V probably benign Het
Wdr72 G A 9: 74,145,094 V136I probably benign Het
Zfp236 T A 18: 82,620,332 N1388Y probably damaging Het
Zfp53 T A 17: 21,508,577 F291I probably damaging Het
Zfp944 A T 17: 22,339,908 H119Q possibly damaging Het
Other mutations in Slc4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Slc4a2 APN 5 24439068 missense probably damaging 1.00
IGL00772:Slc4a2 APN 5 24435196 missense probably damaging 1.00
IGL00897:Slc4a2 APN 5 24429559 nonsense probably null
IGL01477:Slc4a2 APN 5 24430156 unclassified probably benign
IGL01680:Slc4a2 APN 5 24432930 missense probably benign 0.23
IGL01681:Slc4a2 APN 5 24434187 missense probably damaging 1.00
IGL01808:Slc4a2 APN 5 24440207 missense probably damaging 1.00
IGL02399:Slc4a2 APN 5 24434713 missense probably damaging 1.00
IGL02501:Slc4a2 APN 5 24429434 missense probably benign 0.00
IGL03214:Slc4a2 APN 5 24434881 missense probably benign 0.01
R0238:Slc4a2 UTSW 5 24436274 splice site probably null
R0238:Slc4a2 UTSW 5 24436274 splice site probably null
R0309:Slc4a2 UTSW 5 24434346 missense probably damaging 1.00
R0325:Slc4a2 UTSW 5 24435943 missense probably damaging 1.00
R0656:Slc4a2 UTSW 5 24431259 missense probably benign 0.05
R0946:Slc4a2 UTSW 5 24435886 missense probably damaging 1.00
R1075:Slc4a2 UTSW 5 24439057 missense possibly damaging 0.85
R1733:Slc4a2 UTSW 5 24429567 missense probably damaging 1.00
R1794:Slc4a2 UTSW 5 24439328 missense probably damaging 1.00
R1823:Slc4a2 UTSW 5 24427620 missense probably damaging 0.99
R2048:Slc4a2 UTSW 5 24431559 missense probably damaging 1.00
R2165:Slc4a2 UTSW 5 24431316 missense probably damaging 1.00
R2181:Slc4a2 UTSW 5 24435653 missense possibly damaging 0.80
R2405:Slc4a2 UTSW 5 24435601 missense probably damaging 1.00
R3551:Slc4a2 UTSW 5 24430101 missense probably benign 0.01
R4423:Slc4a2 UTSW 5 24439848 nonsense probably null
R4457:Slc4a2 UTSW 5 24434330 unclassified probably benign
R4678:Slc4a2 UTSW 5 24434240 critical splice donor site probably null
R4730:Slc4a2 UTSW 5 24434880 missense probably damaging 1.00
R4824:Slc4a2 UTSW 5 24440143 missense probably damaging 1.00
R4928:Slc4a2 UTSW 5 24435342 critical splice donor site probably null
R4993:Slc4a2 UTSW 5 24434869 missense probably damaging 1.00
R5071:Slc4a2 UTSW 5 24438762 missense probably benign
R5072:Slc4a2 UTSW 5 24438762 missense probably benign
R5073:Slc4a2 UTSW 5 24438762 missense probably benign
R5074:Slc4a2 UTSW 5 24438762 missense probably benign
R5108:Slc4a2 UTSW 5 24439333 missense probably damaging 1.00
R5135:Slc4a2 UTSW 5 24430127 missense possibly damaging 0.78
R5349:Slc4a2 UTSW 5 24435635 missense possibly damaging 0.74
R5601:Slc4a2 UTSW 5 24438774 missense probably benign 0.07
R5666:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R5670:Slc4a2 UTSW 5 24434838 missense probably damaging 1.00
R6256:Slc4a2 UTSW 5 24435890 missense probably damaging 1.00
R6861:Slc4a2 UTSW 5 24435009 missense probably damaging 1.00
R7360:Slc4a2 UTSW 5 24429715 missense probably benign 0.11
R7494:Slc4a2 UTSW 5 24432864 missense possibly damaging 0.91
R7740:Slc4a2 UTSW 5 24431668 splice site probably null
R8087:Slc4a2 UTSW 5 24438749 unclassified probably benign
X0027:Slc4a2 UTSW 5 24435914 splice site probably null
Predicted Primers PCR Primer
(F):5'- GACCAGAAGCCGACTACATTGTCTC -3'
(R):5'- GTGGACATGATCAGCTCTGACACTC -3'

Sequencing Primer
(F):5'- ACATTGTCTCTGTCTGTAGTCAG -3'
(R):5'- CAAGCTCAGTACCTGGTGG -3'
Posted On2013-09-30