Incidental Mutation 'R9287:Ttc41'
ID 704031
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9287 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86763966 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1043 (S1043R)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: S1043R

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: S1043R

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218802
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,345 D918G possibly damaging Het
9430097D07Rik T A 2: 32,575,166 probably benign Het
Aadacl2 C A 3: 60,025,152 H363N probably damaging Het
Ace3 T G 11: 105,997,420 S319A probably damaging Het
Amer3 C T 1: 34,588,819 P713L possibly damaging Het
Aoah T C 13: 21,002,709 L453P probably damaging Het
Asz1 A T 6: 18,051,291 L463Q possibly damaging Het
Bpifb6 T A 2: 153,904,615 V143D probably damaging Het
C87414 G A 5: 93,638,110 H104Y possibly damaging Het
Cad T A 5: 31,072,656 M1499K possibly damaging Het
Casp9 T A 4: 141,807,160 C294S probably benign Het
Ccdc7b T A 8: 129,163,840 S65T probably benign Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Cfap54 T C 10: 92,969,703 Y1515C possibly damaging Het
Chrm5 A C 2: 112,479,265 F502C probably damaging Het
Cnst A T 1: 179,579,543 T52S possibly damaging Het
Cntn6 T C 6: 104,832,510 I502T possibly damaging Het
Col7a1 G A 9: 108,958,389 V617M unknown Het
Ctsb A G 14: 63,133,426 D29G probably benign Het
Cyp3a44 T A 5: 145,788,392 Q333L possibly damaging Het
Dnajc27 T C 12: 4,096,256 V95A possibly damaging Het
Eea1 T A 10: 95,995,583 Y179N probably damaging Het
Erbb2 T C 11: 98,435,281 M961T probably damaging Het
Fat4 G A 3: 38,891,632 G1558D probably damaging Het
Foxh1 T C 15: 76,668,926 E196G probably damaging Het
Gcc2 T A 10: 58,269,395 L151* probably null Het
Gcdh C T 8: 84,889,684 G294D probably damaging Het
Gcnt3 A T 9: 70,034,411 F292I probably damaging Het
Glod4 T C 11: 76,237,684 S131G probably benign Het
Gpc2 G A 5: 138,274,324 L576F unknown Het
Gphn G A 12: 78,562,872 S330N possibly damaging Het
Heatr5a C T 12: 51,920,477 C872Y probably damaging Het
Hephl1 G A 9: 15,084,479 S449L probably benign Het
Hrasls5 T A 19: 7,619,326 Y159* probably null Het
Hrh2 G T 13: 54,214,339 M111I probably benign Het
Igfn1 A G 1: 135,997,806 V70A probably benign Het
Il2 G A 3: 37,125,839 T23I probably damaging Het
Irak4 A G 15: 94,563,036 T382A possibly damaging Het
Itih2 A G 2: 10,123,486 S135P possibly damaging Het
Kansl3 C T 1: 36,349,416 D457N probably damaging Het
Kcns3 A G 12: 11,091,600 I366T probably damaging Het
Kif26a C A 12: 112,179,285 Y1743* probably null Het
Lama4 A T 10: 39,105,964 I1730F probably damaging Het
Lax1 T C 1: 133,680,193 N270S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp6 A G 6: 134,506,296 V482A probably benign Het
Mc5r C A 18: 68,339,129 D186E probably damaging Het
Mcph1 A T 8: 18,607,277 probably null Het
Mgam A G 6: 40,728,971 probably benign Het
Mmrn1 A C 6: 60,975,955 T407P probably damaging Het
Mrpl1 T C 5: 96,238,947 V265A probably benign Het
Mrpl15 C T 1: 4,776,633 G240D probably damaging Het
Msx1 A T 5: 37,821,451 M240K probably damaging Het
Mtf1 T C 4: 124,831,141 L337P probably damaging Het
Muc5ac T A 7: 141,807,889 C1646S probably damaging Het
Mvb12a C A 8: 71,546,994 T219N probably damaging Het
Myo16 G A 8: 10,476,114 V885M unknown Het
N4bp2 T A 5: 65,803,512 S509T probably benign Het
Nckap1 A G 2: 80,553,406 V144A possibly damaging Het
Nkx2-6 G T 14: 69,174,955 G191C possibly damaging Het
Nmnat2 T C 1: 153,086,392 I126T probably damaging Het
Nrp2 C T 1: 62,795,855 R863W probably damaging Het
Nup188 C T 2: 30,336,714 R1168C probably damaging Het
Oas3 T A 5: 120,754,689 D1091V probably damaging Het
Olfr911-ps1 C T 9: 38,523,786 T18I probably damaging Het
Optn T A 2: 5,031,315 Q452L probably damaging Het
Pcca G A 14: 122,616,766 V157I probably benign Het
Pcdha9 A G 18: 36,999,228 D450G probably benign Het
Phrf1 C G 7: 141,260,142 D1083E probably benign Het
Plcb4 G A 2: 135,987,897 A947T probably benign Het
Ppp1r3g G A 13: 35,968,851 D85N possibly damaging Het
Prom2 A C 2: 127,538,265 V349G probably damaging Het
Prrc2c C T 1: 162,714,274 S382N probably benign Het
Rai14 A T 15: 10,592,118 N230K probably benign Het
Rexo5 A T 7: 119,802,802 K142I probably damaging Het
Rgs22 T C 15: 36,098,263 H484R probably damaging Het
Rims2 C T 15: 39,679,690 A1440V probably damaging Het
Serpinb1a T C 13: 32,842,963 E332G probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 AGCTCAGCCACGGGGACC AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC 7: 126,467,578 probably benign Het
Sh2b1 GGACCAGCTC GGACCAGCTCAGCCACGGTGACCAGCTC 7: 126,467,591 probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,467,599 probably benign Het
Slc26a7 C T 4: 14,516,165 G555S possibly damaging Het
Slc4a2 A T 5: 24,434,125 D386V probably damaging Het
Slc6a17 C T 3: 107,477,235 V350M probably damaging Het
Smc2 A G 4: 52,449,361 Y174C probably damaging Het
Smoc2 A G 17: 14,399,424 Y355C probably damaging Het
Smpd1 T A 7: 105,555,235 V107E probably benign Het
Steap4 T G 5: 7,976,683 F215L probably benign Het
Tbc1d1 T A 5: 64,278,021 S501T probably damaging Het
Tec A G 5: 72,768,774 Y312H probably damaging Het
Ticrr C A 7: 79,693,768 T1127K possibly damaging Het
Tlk2 A G 11: 105,256,896 D438G probably benign Het
Tln2 C A 9: 67,370,698 V343L probably benign Het
Tmem156 T A 5: 65,073,805 I241F probably damaging Het
Tmtc1 G T 6: 148,284,892 N559K probably benign Het
Trbv4 A T 6: 41,059,762 I74F probably benign Het
Trmt1l C T 1: 151,453,148 P524S probably damaging Het
Trpa1 A T 1: 14,885,816 C776* probably null Het
Ttn A G 2: 76,746,302 L24749S probably damaging Het
Ube2o C T 11: 116,581,116 G100R probably damaging Het
Unc5b T C 10: 60,773,753 E588G possibly damaging Het
Usp43 G T 11: 67,880,096 Q571K probably damaging Het
Vmn1r127 G A 7: 21,319,002 P287L possibly damaging Het
Wasf3 T A 5: 146,461,047 M208K possibly damaging Het
Xab2 A G 8: 3,613,000 F527S possibly damaging Het
Zfp644 T G 5: 106,637,908 N258H possibly damaging Het
Zfp947 A C 17: 22,145,613 F360C probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACTGTTTGTTGAATGAATGCATGC -3'
(R):5'- CCTTTGACTCTCTGCAGCAAG -3'

Sequencing Primer
(F):5'- ATGAATGCATGCCATATTTCTCCAC -3'
(R):5'- TTTGACTCTCTGCAGCAAGACAAAAG -3'
Posted On 2022-03-25